Incidental Mutation 'R5417:Flvcr2'
ID427799
Institutional Source Beutler Lab
Gene Symbol Flvcr2
Ensembl Gene ENSMUSG00000034258
Gene Namefeline leukemia virus subgroup C cellular receptor 2
SynonymsMfsd7c, CCT
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85746539-85813585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85747191 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 114 (F114V)
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect probably damaging
Transcript: ENSMUST00000040461
AA Change: F114V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: F114V

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Flvcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Flvcr2 APN 12 85747323 missense possibly damaging 0.91
IGL01461:Flvcr2 APN 12 85803131 splice site probably benign
IGL02191:Flvcr2 APN 12 85786192 nonsense probably null
IGL02643:Flvcr2 APN 12 85796223 missense possibly damaging 0.96
IGL02933:Flvcr2 APN 12 85803128 splice site probably benign
pulga UTSW 12 85747191 missense possibly damaging 0.94
R1792:Flvcr2 UTSW 12 85747155 nonsense probably null
R1840:Flvcr2 UTSW 12 85803221 missense possibly damaging 0.91
R2402:Flvcr2 UTSW 12 85783003 missense probably benign 0.12
R4120:Flvcr2 UTSW 12 85786129 missense probably benign 0.31
R4900:Flvcr2 UTSW 12 85782982 missense probably damaging 0.98
R5559:Flvcr2 UTSW 12 85804407 missense probably benign 0.21
R5639:Flvcr2 UTSW 12 85747476 missense probably benign 0.03
R5891:Flvcr2 UTSW 12 85796228 missense possibly damaging 0.74
R6347:Flvcr2 UTSW 12 85747420 missense possibly damaging 0.66
R6349:Flvcr2 UTSW 12 85747200 missense probably benign 0.30
R7082:Flvcr2 UTSW 12 85746954 missense probably benign 0.03
R7179:Flvcr2 UTSW 12 85747191 missense possibly damaging 0.94
R7241:Flvcr2 UTSW 12 85805239 missense probably benign
R7459:Flvcr2 UTSW 12 85747057 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AATTCCAGATGGACACCAGC -3'
(R):5'- ATTTCTCCAGCATCCAGGCC -3'

Sequencing Primer
(F):5'- ATCCATCCCAGCGTCTCAGG -3'
(R):5'- AGCATCCAGGCCACGGG -3'
Posted On2016-09-01