Incidental Mutation 'R5417:Scara5'
ID427801
Institutional Source Beutler Lab
Gene Symbol Scara5
Ensembl Gene ENSMUSG00000022032
Gene Namescavenger receptor class A, member 5
Synonyms4932433F15Rik, 4933425F03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5417 (G1)
Quality Score217
Status Not validated
Chromosome14
Chromosomal Location65666403-65764826 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CG to C at 65759662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022610]
Predicted Effect probably null
Transcript: ENSMUST00000022610
SMART Domains Protein: ENSMUSP00000022610
Gene: ENSMUSG00000022032

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 357 1.8e-8 PFAM
Pfam:Collagen 327 383 1.1e-8 PFAM
SR 389 489 5.5e-56 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in decreased male fertility and lymphocytic infiltration of the stroma of various tissues, particularly in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Scara5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Scara5 APN 14 65738415 splice site probably benign
IGL00772:Scara5 APN 14 65670562 utr 5 prime probably benign
IGL01768:Scara5 APN 14 65689775 nonsense probably null
IGL02081:Scara5 APN 14 65730655 missense possibly damaging 0.96
IGL02280:Scara5 APN 14 65730778 missense probably benign
IGL02795:Scara5 APN 14 65730680 missense possibly damaging 0.72
IGL02887:Scara5 APN 14 65762829 missense unknown
R0040:Scara5 UTSW 14 65762717 splice site probably benign
R0605:Scara5 UTSW 14 65759648 missense possibly damaging 0.85
R0735:Scara5 UTSW 14 65731019 missense possibly damaging 0.85
R0925:Scara5 UTSW 14 65762718 critical splice acceptor site probably benign
R1575:Scara5 UTSW 14 65730865 missense probably benign 0.18
R1746:Scara5 UTSW 14 65731090 missense probably benign
R1968:Scara5 UTSW 14 65689800 missense possibly damaging 0.73
R4455:Scara5 UTSW 14 65762747 missense probably benign 0.01
R4547:Scara5 UTSW 14 65670574 missense possibly damaging 0.72
R4779:Scara5 UTSW 14 65730749 missense probably benign 0.03
R5218:Scara5 UTSW 14 65759662 frame shift probably null
R5316:Scara5 UTSW 14 65689815 missense possibly damaging 0.73
R5331:Scara5 UTSW 14 65759662 frame shift probably null
R5332:Scara5 UTSW 14 65759662 frame shift probably null
R5366:Scara5 UTSW 14 65759662 frame shift probably null
R5367:Scara5 UTSW 14 65759662 frame shift probably null
R5368:Scara5 UTSW 14 65759662 frame shift probably null
R5369:Scara5 UTSW 14 65759662 frame shift probably null
R5418:Scara5 UTSW 14 65759662 frame shift probably null
R5420:Scara5 UTSW 14 65759662 frame shift probably null
R5447:Scara5 UTSW 14 65759662 frame shift probably null
R5473:Scara5 UTSW 14 65740339 missense possibly damaging 0.84
R5580:Scara5 UTSW 14 65731079 missense probably benign 0.02
R7734:Scara5 UTSW 14 65731151 missense possibly damaging 0.85
R7995:Scara5 UTSW 14 65759608 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CACGACACAAGGTAGCCTCATG -3'
(R):5'- ACATGAAGGTGACGCAGACTTTG -3'

Sequencing Primer
(F):5'- CACAAGGTAGCCTCATGGTTTTAGC -3'
(R):5'- CAGGCCTAGCATCCATGGTTTTC -3'
Posted On2016-09-01