Incidental Mutation 'R5417:Arhgap39'
ID427804
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene NameRho GTPase activating protein 39
SynonymsD15Wsu169e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76723985-76818170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76735101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 761 (V761A)
Ref Sequence ENSEMBL: ENSMUSP00000076993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036176
AA Change: V761A

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: V761A

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077821
AA Change: V761A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: V761A

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177011
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76737815 splice site probably benign
IGL01586:Arhgap39 APN 15 76730438 missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76725967 missense probably null 1.00
IGL02017:Arhgap39 APN 15 76737037 missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76724984 makesense probably null
IGL03333:Arhgap39 APN 15 76726732 missense probably benign 0.05
R0328:Arhgap39 UTSW 15 76751952 splice site probably benign
R0432:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76751559 missense probably benign
R1830:Arhgap39 UTSW 15 76735183 missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76725146 missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76725385 missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76751888 missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76725512 unclassified probably benign
R4626:Arhgap39 UTSW 15 76737637 missense possibly damaging 0.92
R4790:Arhgap39 UTSW 15 76726731 missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76741517 missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76737805 missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76725515 unclassified probably benign
R5443:Arhgap39 UTSW 15 76797925 intron probably benign
R5521:Arhgap39 UTSW 15 76765494 missense possibly damaging 0.66
R5686:Arhgap39 UTSW 15 76726633 missense probably damaging 1.00
R5747:Arhgap39 UTSW 15 76741535 missense possibly damaging 0.68
R5785:Arhgap39 UTSW 15 76737418 missense probably benign
R5879:Arhgap39 UTSW 15 76751807 missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6049:Arhgap39 UTSW 15 76727401 critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76730406 nonsense probably null
R6232:Arhgap39 UTSW 15 76736512 missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76737536 missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76735137 missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76737702 missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76737499 missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76765491 missense probably benign 0.09
R7447:Arhgap39 UTSW 15 76765597 start gained probably benign
R7658:Arhgap39 UTSW 15 76737417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAACAGGGTCCATATGCCGG -3'
(R):5'- CTCAGAGACGGACATCGAGAAC -3'

Sequencing Primer
(F):5'- GTCCATATGCCGGTAGATATAGCC -3'
(R):5'- ATCGAGAACTGGGCCTCCAAG -3'
Posted On2016-09-01