Incidental Mutation 'R5417:Mapk8ip2'
ID427805
Institutional Source Beutler Lab
Gene Symbol Mapk8ip2
Ensembl Gene ENSMUSG00000022619
Gene Namemitogen-activated protein kinase 8 interacting protein 2
SynonymsIB2, Jip2, 3230402N03Rik, JNK-interacting protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R5417 (G1)
Quality Score155
Status Not validated
Chromosome15
Chromosomal Location89453913-89464468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89457439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 284 (D284E)
Ref Sequence ENSEMBL: ENSMUSP00000023291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023291] [ENSMUST00000137755]
Predicted Effect probably benign
Transcript: ENSMUST00000023291
AA Change: D284E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023291
Gene: ENSMUSG00000022619
AA Change: D284E

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 85 104 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 300 324 N/A INTRINSIC
low complexity region 419 437 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 589 598 N/A INTRINSIC
SH3 613 670 2.24e-10 SMART
PTB 684 823 1.19e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137755
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to MAPK8IP1/IB1/JIP-1, a scaffold protein that is involved in the c-Jun amino-terminal kinase signaling pathway. This protein is expressed in brain and pancreatic cells. It has been shown to interact with, and regulate the activity of MAPK8/JNK1, and MAP2K7/MKK7 kinases. This protein thus is thought to function as a regulator of signal transduction by protein kinase cascade in brain and pancreatic beta-cells. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele are smaller in size and exhibit male infertility. Mice homozygous for a different knock-out allele exhibit behavioral and cerebellar transmission deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scg3 T A 9: 75,669,256 Y279F probably benign Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Mapk8ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Mapk8ip2 APN 15 89457017 critical splice donor site probably null
IGL02720:Mapk8ip2 APN 15 89457582 missense probably damaging 1.00
IGL02741:Mapk8ip2 APN 15 89457497 missense probably damaging 1.00
IGL03027:Mapk8ip2 APN 15 89458107 missense probably damaging 1.00
PIT4520001:Mapk8ip2 UTSW 15 89460697 missense probably damaging 1.00
R0504:Mapk8ip2 UTSW 15 89456658 missense possibly damaging 0.62
R2355:Mapk8ip2 UTSW 15 89458965 missense probably benign 0.04
R3026:Mapk8ip2 UTSW 15 89461446 missense probably damaging 1.00
R3430:Mapk8ip2 UTSW 15 89457282 missense possibly damaging 0.86
R4275:Mapk8ip2 UTSW 15 89458995 missense probably damaging 1.00
R4789:Mapk8ip2 UTSW 15 89459038 missense probably damaging 1.00
R4953:Mapk8ip2 UTSW 15 89457228 missense probably benign
R5209:Mapk8ip2 UTSW 15 89459287 missense probably damaging 1.00
R5521:Mapk8ip2 UTSW 15 89458804 missense probably damaging 1.00
R6860:Mapk8ip2 UTSW 15 89460452 missense probably damaging 1.00
R7145:Mapk8ip2 UTSW 15 89458998 missense possibly damaging 0.67
R7231:Mapk8ip2 UTSW 15 89458076 missense probably benign
R7369:Mapk8ip2 UTSW 15 89454251 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCGGATCCTGGTATTGAG -3'
(R):5'- AGGAGCCCTCAGAGATCATG -3'

Sequencing Primer
(F):5'- GGCTGACTTGAGAAGCCACTCTAG -3'
(R):5'- TCAGAGATCATGCGGCTCAC -3'
Posted On2016-09-01