Mutagenetix > Incidental Mutations

Incidental Mutation 'R5417:Epha6'

427808

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5417 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 60424835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 334 (A334S)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068860
AA Change: A334S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: A334S

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159383

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	G	15: 76,735,101	V761A	possibly damaging	Het
Ccdc47	C	T	11: 106,210,350	R162Q	probably benign	Het
Cfap65	T	C	1: 74,925,100	E563G	probably damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Col17a1	C	A	19: 47,662,390	G732C	probably damaging	Het
Cped1	A	G	6: 22,233,580	I812V	probably null	Het
Dennd1c	CCGCCCCTCGCTGACAGC	CC	17: 57,066,755		probably null	Het
Dgkg	A	T	16: 22,588,331	M168K	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dolpp1	T	C	2: 30,396,237	L18P	probably damaging	Het
Eif3e	A	T	15: 43,265,521	D234E	probably benign	Het
Fbxw10	G	A	11: 62,877,164	R942Q	possibly damaging	Het
Flvcr2	T	G	12: 85,747,191	F114V	probably damaging	Het
Gm14443	A	T	2: 175,170,003	C217S	probably damaging	Het
Gphb5	A	T	12: 75,412,972	V83E	possibly damaging	Het
Gpsm1	T	C	2: 26,324,033		probably null	Het
Grik4	A	G	9: 42,671,248	F134S	probably benign	Het
Ibsp	G	A	5: 104,310,469	E291K	possibly damaging	Het
Igfals	T	G	17: 24,880,316	L127R	probably damaging	Het
Igsf9b	CGGCCCCGGCCCAG	CGGCCCCGGCCCAGGCCCCGGCCCAG	9: 27,334,276		probably benign	Het
Iqcf3	T	A	9: 106,554,214	D63V	probably damaging	Het
Klc4	A	G	17: 46,632,031		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mapk8ip2	C	A	15: 89,457,439	D284E	probably benign	Het
Muc5b	A	T	7: 141,858,044	T1576S	unknown	Het
Nlrp3	G	A	11: 59,549,063	G489S	probably damaging	Het
Nr5a1	T	A	2: 38,708,086	Q233L	possibly damaging	Het
Nusap1	G	A	2: 119,647,143	V345I	probably damaging	Het
Olfr1301	A	G	2: 111,754,920	T224A	possibly damaging	Het
Olfr1494	A	G	19: 13,749,853	H249R	probably benign	Het
Olfr612	A	T	7: 103,538,763	V157E	possibly damaging	Het
Oxr1	A	G	15: 41,820,371	T378A	probably benign	Het
Pcdhb12	T	C	18: 37,436,034	F78L	probably benign	Het
Pgm2l1	A	T	7: 100,272,376	I605L	probably benign	Het
Pik3c2g	A	G	6: 139,736,943	I17V	probably benign	Het
Prss39	A	G	1: 34,500,128	S150G	probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scg3	T	A	9: 75,669,256	Y279F	probably benign	Het
Skiv2l	C	T	17: 34,846,598	V327I	probably damaging	Het
Srfbp1	T	C	18: 52,488,625	C253R	probably benign	Het
Tcirg1	C	T	19: 3,903,509		probably null	Het
Trim37	A	G	11: 87,166,679	Y313C	probably damaging	Het
Ttll9	A	T	2: 153,002,992	M427L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGAAGCACAGTAGCATC -3'
(R):5'- ACTCAACACTGAAATCCGTGAG -3'

Sequencing Primer
(F):5'- CTTACCATGGCAAGAACC -3'
(R):5'- TGGGGCCTATAGAAAGGAAAGG -3'

Posted On

2016-09-01