Incidental Mutation 'R5418:Glrx2'
ID427823
Institutional Source Beutler Lab
Gene Symbol Glrx2
Ensembl Gene ENSMUSG00000018196
Gene Nameglutaredoxin 2 (thioltransferase)
SynonymsGrx2, 1700010P22Rik
MMRRC Submission 042986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5418 (G1)
Quality Score202
Status Validated
Chromosome1
Chromosomal Location143716338-143749676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 143739708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 16 (S16R)
Ref Sequence ENSEMBL: ENSMUSP00000053443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050491] [ENSMUST00000111957] [ENSMUST00000129653] [ENSMUST00000145571] [ENSMUST00000145969] [ENSMUST00000185362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050491
AA Change: S16R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053443
Gene: ENSMUSG00000018196
AA Change: S16R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111957
SMART Domains Protein: ENSMUSP00000107588
Gene: ENSMUSG00000018196

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126514
Predicted Effect probably benign
Transcript: ENSMUST00000129653
SMART Domains Protein: ENSMUSP00000121010
Gene: ENSMUSG00000018196

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145571
AA Change: S16R
SMART Domains Protein: ENSMUSP00000115893
Gene: ENSMUSG00000018196
AA Change: S16R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 117 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145969
SMART Domains Protein: ENSMUSP00000121665
Gene: ENSMUSG00000018196

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149103
Predicted Effect probably benign
Transcript: ENSMUST00000185362
AA Change: S16R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141022
Gene: ENSMUSG00000018196
AA Change: S16R

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190211
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in primary mouse lens epithelial cells, and an increased level of glutathionylated proteins in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Crlf2 A G 5: 109,557,033 V104A probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Klra6 T A 6: 130,013,430 L239F probably damaging Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mapk14 T C 17: 28,741,843 V196A possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Piezo1 A G 8: 122,486,780 L1793P probably damaging Het
Pkp4 T C 2: 59,310,162 V404A probably benign Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Glrx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:Glrx2 APN 1 143739683 missense possibly damaging 0.66
R1728:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1762:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1783:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1784:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1785:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R2132:Glrx2 UTSW 1 143745104 missense possibly damaging 0.92
R4362:Glrx2 UTSW 1 143741680 missense possibly damaging 0.71
R5496:Glrx2 UTSW 1 143745207 missense probably damaging 0.98
R5952:Glrx2 UTSW 1 143745134 missense probably benign 0.03
R6225:Glrx2 UTSW 1 143745383 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCGGGAGAACTCGGTAGAGATC -3'
(R):5'- ACGCTGAGTTAAAACCACATGC -3'

Sequencing Primer
(F):5'- AGGTGAGTGCCTCGCTCTAC -3'
(R):5'- CCACATGCTGTATTTGTTAAGCTCAG -3'
Posted On2016-09-01