Incidental Mutation 'R5419:Fkbp15'
ID427909
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5419 (G1)
Quality Score185
Status Not validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62327877 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 438 (A438V)
Ref Sequence ENSEMBL: ENSMUSP00000081575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033] [ENSMUST00000107461]
Predicted Effect probably damaging
Transcript: ENSMUST00000084527
AA Change: A438V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: A438V

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084528
AA Change: A438V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: A438V

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098033
AA Change: A438V

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151
AA Change: A438V

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107461
AA Change: A438V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103085
Gene: ENSMUSG00000066151
AA Change: A438V

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.86e-8 PROSPERO
internal_repeat_1 472 500 1.86e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139308
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GACTTGGAGAACTGCTGCTG -3'
(R):5'- CATGCTCGCACATACTTGGC -3'

Sequencing Primer
(F):5'- AGTTTGAAGCCAGCCTGATC -3'
(R):5'- CTTGGCTCCAACATAAATGATCTC -3'
Posted On2016-09-01