Incidental Mutation 'R5419:Paf1'
ID427921
Institutional Source Beutler Lab
Gene Symbol Paf1
Ensembl Gene ENSMUSG00000003437
Gene NamePaf1, RNA polymerase II complex component
Synonyms5730511K23Rik
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28392951-28399388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28395670 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000003529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003529] [ENSMUST00000003536] [ENSMUST00000040531] [ENSMUST00000208199]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003529
AA Change: I112V

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003529
Gene: ENSMUSG00000003437
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Paf1 28 441 2.3e-154 PFAM
low complexity region 456 470 N/A INTRINSIC
low complexity region 476 511 N/A INTRINSIC
low complexity region 514 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003536
SMART Domains Protein: ENSMUSP00000003536
Gene: ENSMUSG00000003444

DomainStartEndE-ValueType
Pfam:Med29 51 186 7.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Predicted Effect probably benign
Transcript: ENSMUST00000208199
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Paf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Paf1 APN 7 28398690 unclassified probably benign
IGL02583:Paf1 APN 7 28396171 missense probably damaging 0.98
IGL02965:Paf1 APN 7 28396204 critical splice donor site probably null
IGL03117:Paf1 APN 7 28395056 missense possibly damaging 0.92
K3955:Paf1 UTSW 7 28396925 splice site probably null
P0038:Paf1 UTSW 7 28396925 splice site probably null
R0445:Paf1 UTSW 7 28395688 missense probably damaging 1.00
R1389:Paf1 UTSW 7 28398832 unclassified probably benign
R1808:Paf1 UTSW 7 28396822 missense probably damaging 1.00
R2006:Paf1 UTSW 7 28395768 splice site probably null
R5213:Paf1 UTSW 7 28395972 missense possibly damaging 0.71
R5413:Paf1 UTSW 7 28396615 missense possibly damaging 0.82
R5795:Paf1 UTSW 7 28396618 missense probably damaging 0.97
R7378:Paf1 UTSW 7 28396928 missense probably damaging 1.00
R7502:Paf1 UTSW 7 28395868 missense possibly damaging 0.91
R7629:Paf1 UTSW 7 28395068 missense probably damaging 1.00
R7896:Paf1 UTSW 7 28396647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGACTGAGCCAGATCTG -3'
(R):5'- ACTTCAGGCTTCTCATTGGAG -3'

Sequencing Primer
(F):5'- CAGATCTGGGGGTCACCATTGATC -3'
(R):5'- GGAGATGCCATATCTGTTGAACTCAG -3'
Posted On2016-09-01