Mutagenetix > Incidental Mutations

Incidental Mutation 'R5419:Ces5a'

427927

Institutional Source

Beutler Lab

Gene Symbol

Ces5a

Ensembl Gene

ENSMUSG00000058019

Gene Name

carboxylesterase 5A

Synonyms

Ces7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin

MMRRC Submission

042987-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R5419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93499064-93535830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93499431 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 559 (S559T)

Ref Sequence

ENSEMBL: ENSMUSP00000148481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009]

Predicted Effect

unknown
Transcript: ENSMUST00000077816
AA Change: S559T

SMART Domains

Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: S559T

Domain	Start	End	E-Value	Type
Pfam:COesterase	10	539	3.2e-157	PFAM
Pfam:Abhydrolase_3	141	238	9.5e-7	PFAM
low complexity region	552	575	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000080391

SMART Domains

Protein: ENSMUSP00000079254
Gene: ENSMUSG00000058019

Domain	Start	End	E-Value	Type
Pfam:COesterase	83	208	2.3e-23	PFAM
low complexity region	221	244	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000212009
AA Change: S559T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212690

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,272,090	L926*	probably null	Het
4931429L15Rik	C	T	9: 46,309,326		probably null	Het
Abca13	T	A	11: 9,193,533		probably null	Het
AI481877	A	T	4: 59,049,017	M1116K	probably benign	Het
Akap13	A	T	7: 75,610,243	T69S	probably benign	Het
Arl1	T	A	10: 88,737,104	C80S	probably damaging	Het
Brsk1	A	G	7: 4,709,004	T618A	possibly damaging	Het
Cep295	T	C	9: 15,324,237	H1982R	probably damaging	Het
Clcf1	A	G	19: 4,222,159	N90S	possibly damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Cobll1	A	T	2: 65,103,357	D430E	possibly damaging	Het
Cyp1a2	T	A	9: 57,682,511	I7F	probably benign	Het
Cyp2b23	G	A	7: 26,681,423	R126*	probably null	Het
Daam2	A	G	17: 49,480,754	W444R	possibly damaging	Het
Dcbld2	T	A	16: 58,455,258	C446S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eif2d	T	C	1: 131,158,298	*177R	probably null	Het
Fkbp15	G	A	4: 62,327,877	A438V	probably damaging	Het
Gjb5	G	A	4: 127,355,859	A164V	probably benign	Het
Gm17727	T	A	9: 35,778,111		probably null	Het
Gm5724	C	T	6: 141,736,100		probably null	Het
Grin1	A	T	2: 25,298,273		probably null	Het
Grm3	A	G	5: 9,570,233	F337S	probably damaging	Het
Hey2	T	A	10: 30,834,023	T245S	probably benign	Het
Ifi206	T	C	1: 173,481,231	T400A	probably benign	Het
Itga7	G	A	10: 128,944,033	E480K	probably null	Het
Itpr1	T	C	6: 108,493,794	Y2227H	possibly damaging	Het
Krt8	T	C	15: 102,003,902	D113G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	A	G	7: 66,708,095		probably benign	Het
Lmf1	A	T	17: 25,662,636	D553V	possibly damaging	Het
Lnpep	A	G	17: 17,566,730	S536P	probably damaging	Het
Lrp1b	A	T	2: 40,730,704	C3587*	probably null	Het
Macf1	A	T	4: 123,397,124	D3435E	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Myg1	A	T	15: 102,336,962	N206I	probably damaging	Het
Myl12a	T	G	17: 70,994,699	R144S	probably benign	Het
Myo5a	T	A	9: 75,147,897	I454K	probably damaging	Het
Nwd2	A	G	5: 63,807,708	D1545G	probably benign	Het
Ogdhl	T	G	14: 32,339,224	D457E	probably damaging	Het
Olfr202	T	A	16: 59,284,341	D52V	probably damaging	Het
Olfr466	A	C	13: 65,152,774	L183F	probably damaging	Het
Paf1	A	G	7: 28,395,670	I112V	possibly damaging	Het
Pcdhga4	C	T	18: 37,686,745	P449L	probably damaging	Het
Pla2g6	A	T	15: 79,299,142	I495N	possibly damaging	Het
Ptgs1	A	G	2: 36,237,222	Y40C	probably damaging	Het
Ptprn2	A	T	12: 117,184,647	I676F	probably damaging	Het
Rev3l	T	C	10: 39,824,931	L1808P	possibly damaging	Het
Sall2	A	G	14: 52,313,129	S868P	probably damaging	Het
Slc47a2	A	G	11: 61,307,586	F428L	probably benign	Het
Slco3a1	A	T	7: 74,284,615	F603Y	possibly damaging	Het
Smyd2	A	T	1: 189,909,893	C65*	probably null	Het
Ssu72	T	C	4: 155,715,550	F57L	probably damaging	Het
Tanc2	A	G	11: 105,922,883	T1718A	probably benign	Het
Tnks	G	C	8: 34,965,566	P34A	unknown	Het
Top3a	G	A	11: 60,762,522	T42I	probably damaging	Het
Trank1	T	C	9: 111,391,301	S2369P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqln1	T	C	13: 58,183,183	Q410R	probably damaging	Het
Vmn2r11	A	G	5: 109,059,358	I32T	possibly damaging	Het
Xcr1	A	G	9: 123,856,310	F129S	probably benign	Het

Other mutations in Ces5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Ces5a	APN	8	93525544	critical splice donor site	probably null
IGL01520:Ces5a	APN	8	93519578	missense	probably benign	0.08
IGL01674:Ces5a	APN	8	93502219	missense	probably damaging	1.00
IGL02257:Ces5a	APN	8	93525598	missense	probably benign	0.00
IGL02456:Ces5a	APN	8	93528644	splice site	probably benign
IGL03027:Ces5a	APN	8	93523114	splice site	probably null
IGL03051:Ces5a	APN	8	93528598	missense	probably damaging	1.00
IGL03264:Ces5a	APN	8	93502270	missense	possibly damaging	0.74
IGL03290:Ces5a	APN	8	93519632	missense	probably damaging	1.00
R0115:Ces5a	UTSW	8	93502183	missense	probably damaging	0.98
R0124:Ces5a	UTSW	8	93528555	missense	probably damaging	1.00
R0521:Ces5a	UTSW	8	93525658	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1524:Ces5a	UTSW	8	93525665	missense	probably damaging	0.96
R1843:Ces5a	UTSW	8	93514231	missense	probably damaging	1.00
R2029:Ces5a	UTSW	8	93534577	missense	probably damaging	1.00
R2135:Ces5a	UTSW	8	93499741	missense	probably benign	0.33
R2146:Ces5a	UTSW	8	93534699	missense	probably benign	0.03
R2973:Ces5a	UTSW	8	93528504	missense	probably damaging	1.00
R3755:Ces5a	UTSW	8	93528502	missense	probably benign	0.15
R4755:Ces5a	UTSW	8	93535677	missense	probably benign	0.39
R5072:Ces5a	UTSW	8	93534668	missense	probably damaging	1.00
R5278:Ces5a	UTSW	8	93525638	missense	probably damaging	1.00
R5825:Ces5a	UTSW	8	93525667	missense	probably damaging	1.00
R6318:Ces5a	UTSW	8	93534583	missense	probably damaging	1.00
R6925:Ces5a	UTSW	8	93523057	splice site	probably null
R6950:Ces5a	UTSW	8	93530774	missense	probably benign	0.10
R7148:Ces5a	UTSW	8	93502322	missense	probably damaging	1.00
R7256:Ces5a	UTSW	8	93499526	missense	probably benign	0.13
R7290:Ces5a	UTSW	8	93534683	missense	probably damaging	1.00
R7459:Ces5a	UTSW	8	93535741	start gained	probably benign
R7674:Ces5a	UTSW	8	93514269	missense	probably damaging	1.00
R7815:Ces5a	UTSW	8	93520995	missense	possibly damaging	0.79
R8150:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
X0024:Ces5a	UTSW	8	93514213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTATGAGGTTCATCCCTAAGCCC -3'
(R):5'- TGACTGCTCTCACTTCCAGG -3'

Sequencing Primer
(F):5'- GAGGTTCATCCCTAAGCCCATAAAAC -3'
(R):5'- TCACTTCCAGGGATCCTAACGG -3'

Posted On

2016-09-01