Incidental Mutation 'R5419:Cyp1a2'
ID427932
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 2
SynonymsCP12, aromatic compound inducible, P450-3
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57676937-57683703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57682511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 7 (I7F)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
Predicted Effect probably benign
Transcript: ENSMUST00000034860
AA Change: I7F

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: I7F

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215792
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57682069 nonsense probably null
IGL01161:Cyp1a2 APN 9 57679893 missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57682372 missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57682202 missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57682395 missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57677228 makesense probably null
IGL03349:Cyp1a2 APN 9 57679875 missense possibly damaging 0.82
broadway UTSW 9 57677233 nonsense probably null
PIT4515001:Cyp1a2 UTSW 9 57681959 missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57682061 missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57682025 missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57680246 splice site probably benign
R0589:Cyp1a2 UTSW 9 57679062 missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57681767 missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57682286 missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57682150 missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57677515 missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57679949 missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57681868 missense probably benign
R5225:Cyp1a2 UTSW 9 57677233 nonsense probably null
R5471:Cyp1a2 UTSW 9 57679020 missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57681053 missense probably benign
R6017:Cyp1a2 UTSW 9 57681030 missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57677260 missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57682156 missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57677242 missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57681878 missense probably benign
R7081:Cyp1a2 UTSW 9 57678989 missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57681940 missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57682337 missense probably benign 0.05
R8097:Cyp1a2 UTSW 9 57679553 splice site probably null
RF007:Cyp1a2 UTSW 9 57681970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCATACTGCTGACTCAG -3'
(R):5'- TAAATGCAAGGCTCCTTCCCAG -3'

Sequencing Primer
(F):5'- TGACTCAGCCGTGTCAGTGAC -3'
(R):5'- AACAAGACACAGGACAGGTATATTC -3'
Posted On2016-09-01