Mutagenetix > Incidental Mutations

Incidental Mutation 'R5419:Itga7'

427939

Institutional Source

Beutler Lab

Gene Symbol

Itga7

Ensembl Gene

ENSMUSG00000025348

Gene Name

integrin alpha 7

Synonyms

[a]7, alpha7

MMRRC Submission

042987-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.415) question?

Stock #

R5419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128933818-128958282 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128944033 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 480 (E480K)

Ref Sequence

ENSEMBL: ENSMUSP00000096712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000099112] [ENSMUST00000218290]

Predicted Effect

probably null
Transcript: ENSMUST00000099112
AA Change: E480K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: E480K

Domain	Start	End	E-Value	Type
Int_alpha	48	110	4.11e-6	SMART
Int_alpha	259	312	3.72e-4	SMART
Int_alpha	316	372	1.16e-14	SMART
Int_alpha	377	430	9.21e-18	SMART
Int_alpha	435	490	4.38e-1	SMART
low complexity region	510	523	N/A	INTRINSIC
SCOP:d1m1xa3	807	1039	6e-50	SMART
low complexity region	1041	1058	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099112
AA Change: E480K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: E480K

Domain	Start	End	E-Value	Type
Int_alpha	48	110	4.11e-6	SMART
Int_alpha	259	312	3.72e-4	SMART
Int_alpha	316	372	1.16e-14	SMART
Int_alpha	377	430	9.21e-18	SMART
Int_alpha	435	490	4.38e-1	SMART
low complexity region	510	523	N/A	INTRINSIC
SCOP:d1m1xa3	807	1039	6e-50	SMART
low complexity region	1041	1058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158143

Predicted Effect

probably null
Transcript: ENSMUST00000218290
AA Change: E484K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218387

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,272,090	L926*	probably null	Het
4931429L15Rik	C	T	9: 46,309,326		probably null	Het
Abca13	T	A	11: 9,193,533		probably null	Het
AI481877	A	T	4: 59,049,017	M1116K	probably benign	Het
Akap13	A	T	7: 75,610,243	T69S	probably benign	Het
Arl1	T	A	10: 88,737,104	C80S	probably damaging	Het
Brsk1	A	G	7: 4,709,004	T618A	possibly damaging	Het
Cep295	T	C	9: 15,324,237	H1982R	probably damaging	Het
Ces5a	A	T	8: 93,499,431	S559T	unknown	Het
Clcf1	A	G	19: 4,222,159	N90S	possibly damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Cobll1	A	T	2: 65,103,357	D430E	possibly damaging	Het
Cyp1a2	T	A	9: 57,682,511	I7F	probably benign	Het
Cyp2b23	G	A	7: 26,681,423	R126*	probably null	Het
Daam2	A	G	17: 49,480,754	W444R	possibly damaging	Het
Dcbld2	T	A	16: 58,455,258	C446S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eif2d	T	C	1: 131,158,298	*177R	probably null	Het
Fkbp15	G	A	4: 62,327,877	A438V	probably damaging	Het
Gjb5	G	A	4: 127,355,859	A164V	probably benign	Het
Gm17727	T	A	9: 35,778,111		probably null	Het
Gm5724	C	T	6: 141,736,100		probably null	Het
Grin1	A	T	2: 25,298,273		probably null	Het
Grm3	A	G	5: 9,570,233	F337S	probably damaging	Het
Hey2	T	A	10: 30,834,023	T245S	probably benign	Het
Ifi206	T	C	1: 173,481,231	T400A	probably benign	Het
Itpr1	T	C	6: 108,493,794	Y2227H	possibly damaging	Het
Krt8	T	C	15: 102,003,902	D113G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	A	G	7: 66,708,095		probably benign	Het
Lmf1	A	T	17: 25,662,636	D553V	possibly damaging	Het
Lnpep	A	G	17: 17,566,730	S536P	probably damaging	Het
Lrp1b	A	T	2: 40,730,704	C3587*	probably null	Het
Macf1	A	T	4: 123,397,124	D3435E	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Myg1	A	T	15: 102,336,962	N206I	probably damaging	Het
Myl12a	T	G	17: 70,994,699	R144S	probably benign	Het
Myo5a	T	A	9: 75,147,897	I454K	probably damaging	Het
Nwd2	A	G	5: 63,807,708	D1545G	probably benign	Het
Ogdhl	T	G	14: 32,339,224	D457E	probably damaging	Het
Olfr202	T	A	16: 59,284,341	D52V	probably damaging	Het
Olfr466	A	C	13: 65,152,774	L183F	probably damaging	Het
Paf1	A	G	7: 28,395,670	I112V	possibly damaging	Het
Pcdhga4	C	T	18: 37,686,745	P449L	probably damaging	Het
Pla2g6	A	T	15: 79,299,142	I495N	possibly damaging	Het
Ptgs1	A	G	2: 36,237,222	Y40C	probably damaging	Het
Ptprn2	A	T	12: 117,184,647	I676F	probably damaging	Het
Rev3l	T	C	10: 39,824,931	L1808P	possibly damaging	Het
Sall2	A	G	14: 52,313,129	S868P	probably damaging	Het
Slc47a2	A	G	11: 61,307,586	F428L	probably benign	Het
Slco3a1	A	T	7: 74,284,615	F603Y	possibly damaging	Het
Smyd2	A	T	1: 189,909,893	C65*	probably null	Het
Ssu72	T	C	4: 155,715,550	F57L	probably damaging	Het
Tanc2	A	G	11: 105,922,883	T1718A	probably benign	Het
Tnks	G	C	8: 34,965,566	P34A	unknown	Het
Top3a	G	A	11: 60,762,522	T42I	probably damaging	Het
Trank1	T	C	9: 111,391,301	S2369P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqln1	T	C	13: 58,183,183	Q410R	probably damaging	Het
Vmn2r11	A	G	5: 109,059,358	I32T	possibly damaging	Het
Xcr1	A	G	9: 123,856,310	F129S	probably benign	Het

Other mutations in Itga7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Itga7	APN	10	128941854	missense	possibly damaging	0.67
IGL00809:Itga7	APN	10	128939169	critical splice donor site	probably null
IGL01448:Itga7	APN	10	128949468	nonsense	probably null
IGL01675:Itga7	APN	10	128946855	missense	probably damaging	1.00
IGL02158:Itga7	APN	10	128953782	missense	possibly damaging	0.95
IGL02475:Itga7	APN	10	128934089	missense	probably damaging	1.00
IGL02689:Itga7	APN	10	128946818	missense	possibly damaging	0.83
IGL02946:Itga7	APN	10	128934083	missense	probably benign
IGL03223:Itga7	APN	10	128948811	unclassified	probably benign
R0662:Itga7	UTSW	10	128953531	missense	probably damaging	1.00
R0972:Itga7	UTSW	10	128942877	missense	probably damaging	0.98
R1449:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R1521:Itga7	UTSW	10	128957811	missense	possibly damaging	0.63
R1597:Itga7	UTSW	10	128946863	missense	probably benign	0.17
R1651:Itga7	UTSW	10	128948824	missense	probably benign	0.01
R4718:Itga7	UTSW	10	128940734	frame shift	probably null
R5011:Itga7	UTSW	10	128949447	missense	possibly damaging	0.51
R5151:Itga7	UTSW	10	128944511	missense	possibly damaging	0.91
R5287:Itga7	UTSW	10	128943158	missense	probably benign	0.38
R5907:Itga7	UTSW	10	128942981	missense	probably damaging	1.00
R6165:Itga7	UTSW	10	128942935	missense	probably benign	0.16
R6189:Itga7	UTSW	10	128950403	missense	possibly damaging	0.76
R6263:Itga7	UTSW	10	128944086	missense	probably benign
R6612:Itga7	UTSW	10	128948993	missense	possibly damaging	0.65
R6746:Itga7	UTSW	10	128949472	missense	probably benign	0.13
R6850:Itga7	UTSW	10	128945516	missense	probably damaging	1.00
R7226:Itga7	UTSW	10	128940932	missense	probably damaging	0.98
R7257:Itga7	UTSW	10	128944413	missense	possibly damaging	0.55
R7344:Itga7	UTSW	10	128940929	missense	possibly damaging	0.63
R7456:Itga7	UTSW	10	128941936	missense	probably damaging	1.00
R7545:Itga7	UTSW	10	128933906	start gained	probably benign
R7643:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R7644:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R7822:Itga7	UTSW	10	128942966	missense	probably benign	0.00
R7998:Itga7	UTSW	10	128934151	missense	probably damaging	1.00
X0020:Itga7	UTSW	10	128942877	missense	probably damaging	0.98
Z1088:Itga7	UTSW	10	128949163	missense	probably benign	0.10
Z1176:Itga7	UTSW	10	128953827	missense	probably benign	0.12
Z1177:Itga7	UTSW	10	128943214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTACCCAGACCTGCTTG -3'
(R):5'- GGAGACTTCTTAGCAAACAAGACTC -3'

Sequencing Primer
(F):5'- AGACCTGCTTGTGGGCTC -3'
(R):5'- TTCTTAGCAAACAAGACTCCAAAC -3'

Posted On

2016-09-01