Incidental Mutation 'R5419:Itga7'
ID427939
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Nameintegrin alpha 7
Synonyms[a]7, alpha7
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128933818-128958282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128944033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 480 (E480K)
Ref Sequence ENSEMBL: ENSMUSP00000096712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably null
Transcript: ENSMUST00000099112
AA Change: E480K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: E480K

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099112
AA Change: E480K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: E480K

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158143
Predicted Effect probably null
Transcript: ENSMUST00000218290
AA Change: E484K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218387
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128941854 missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128939169 critical splice donor site probably null
IGL01448:Itga7 APN 10 128949468 nonsense probably null
IGL01675:Itga7 APN 10 128946855 missense probably damaging 1.00
IGL02158:Itga7 APN 10 128953782 missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128934089 missense probably damaging 1.00
IGL02689:Itga7 APN 10 128946818 missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128934083 missense probably benign
IGL03223:Itga7 APN 10 128948811 unclassified probably benign
R0662:Itga7 UTSW 10 128953531 missense probably damaging 1.00
R0972:Itga7 UTSW 10 128942877 missense probably damaging 0.98
R1449:Itga7 UTSW 10 128953501 missense probably benign 0.13
R1521:Itga7 UTSW 10 128957811 missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128946863 missense probably benign 0.17
R1651:Itga7 UTSW 10 128948824 missense probably benign 0.01
R4718:Itga7 UTSW 10 128940734 frame shift probably null
R5011:Itga7 UTSW 10 128949447 missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128944511 missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128943158 missense probably benign 0.38
R5907:Itga7 UTSW 10 128942981 missense probably damaging 1.00
R6165:Itga7 UTSW 10 128942935 missense probably benign 0.16
R6189:Itga7 UTSW 10 128950403 missense possibly damaging 0.76
R6263:Itga7 UTSW 10 128944086 missense probably benign
R6612:Itga7 UTSW 10 128948993 missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128949472 missense probably benign 0.13
R6850:Itga7 UTSW 10 128945516 missense probably damaging 1.00
R7226:Itga7 UTSW 10 128940932 missense probably damaging 0.98
R7257:Itga7 UTSW 10 128944413 missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128940929 missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128941936 missense probably damaging 1.00
R7545:Itga7 UTSW 10 128933906 start gained probably benign
R7643:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7644:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7822:Itga7 UTSW 10 128942966 missense probably benign 0.00
X0020:Itga7 UTSW 10 128942877 missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128949163 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCACTACCCAGACCTGCTTG -3'
(R):5'- GGAGACTTCTTAGCAAACAAGACTC -3'

Sequencing Primer
(F):5'- AGACCTGCTTGTGGGCTC -3'
(R):5'- TTCTTAGCAAACAAGACTCCAAAC -3'
Posted On2016-09-01