Incidental Mutation 'R5419:Top3a'
ID427941
Institutional Source Beutler Lab
Gene Symbol Top3a
Ensembl Gene ENSMUSG00000002814
Gene Nametopoisomerase (DNA) III alpha
SynonymsTop IIIa
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60740058-60777365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60762522 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 42 (T42I)
Ref Sequence ENSEMBL: ENSMUSP00000115727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably damaging
Transcript: ENSMUST00000002891
AA Change: T87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814
AA Change: T87I

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102668
AA Change: T87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814
AA Change: T87I

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117743
AA Change: T62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814
AA Change: T62I

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120417
AA Change: T62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814
AA Change: T62I

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130068
AA Change: T42I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814
AA Change: T42I

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele die shortly after implantation and the induction of decidual reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Top3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Top3a APN 11 60761736 missense probably damaging 1.00
IGL02935:Top3a APN 11 60762528 missense possibly damaging 0.53
R0057:Top3a UTSW 11 60740684 missense probably benign
R0057:Top3a UTSW 11 60740684 missense probably benign
R0369:Top3a UTSW 11 60742789 missense probably damaging 1.00
R1171:Top3a UTSW 11 60750593 missense probably benign 0.02
R1459:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1621:Top3a UTSW 11 60750607 missense probably damaging 1.00
R1812:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1839:Top3a UTSW 11 60753888 missense probably damaging 1.00
R1873:Top3a UTSW 11 60747984 nonsense probably null
R2004:Top3a UTSW 11 60742489 missense probably damaging 0.99
R2277:Top3a UTSW 11 60745874 missense possibly damaging 0.95
R2406:Top3a UTSW 11 60756012 missense probably damaging 1.00
R2418:Top3a UTSW 11 60748016 missense possibly damaging 0.95
R3196:Top3a UTSW 11 60759356 missense probably damaging 1.00
R3879:Top3a UTSW 11 60743939 missense possibly damaging 0.92
R4695:Top3a UTSW 11 60742412 missense probably benign 0.40
R4715:Top3a UTSW 11 60742997 nonsense probably null
R4768:Top3a UTSW 11 60762490 missense probably damaging 1.00
R4910:Top3a UTSW 11 60752378 splice site probably benign
R5305:Top3a UTSW 11 60762539 missense possibly damaging 0.56
R5387:Top3a UTSW 11 60762490 missense probably damaging 1.00
R5806:Top3a UTSW 11 60776920 critical splice donor site probably null
R6162:Top3a UTSW 11 60745937 missense probably damaging 1.00
R6279:Top3a UTSW 11 60749408 missense probably benign 0.02
R6300:Top3a UTSW 11 60749408 missense probably benign 0.02
R6381:Top3a UTSW 11 60744023 missense probably damaging 1.00
R6383:Top3a UTSW 11 60749459 missense probably benign 0.30
R6767:Top3a UTSW 11 60750753 missense possibly damaging 0.84
R6919:Top3a UTSW 11 60749493 missense probably damaging 1.00
R7299:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7301:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7442:Top3a UTSW 11 60753918 missense possibly damaging 0.66
R7690:Top3a UTSW 11 60756380 missense probably damaging 1.00
R7786:Top3a UTSW 11 60776966 missense probably damaging 1.00
R7792:Top3a UTSW 11 60742964 missense probably benign
X0063:Top3a UTSW 11 60750644 nonsense probably null
X0065:Top3a UTSW 11 60763398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTTGCACTGAAAAGAGTG -3'
(R):5'- AATGGTGGCTGTATCAACATGG -3'

Sequencing Primer
(F):5'- CTTACAGCAGGTCATATAGCCTTAGG -3'
(R):5'- ATCAACATGGTTTTGGTTTTGCC -3'
Posted On2016-09-01