Incidental Mutation 'R5419:Ptprn2'
ID 427945
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 042987-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R5419 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117148267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 676 (I676F)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect possibly damaging
Transcript: ENSMUST00000070733
AA Change: I676F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: I676F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: I676F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: I676F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,220,624 (GRCm39) probably null Het
Abca13 T A 11: 9,143,533 (GRCm39) probably null Het
Akap13 A T 7: 75,259,991 (GRCm39) T69S probably benign Het
Arl1 T A 10: 88,572,966 (GRCm39) C80S probably damaging Het
Bltp2 T A 11: 78,162,916 (GRCm39) L926* probably null Het
Brsk1 A G 7: 4,712,003 (GRCm39) T618A possibly damaging Het
Cep295 T C 9: 15,235,533 (GRCm39) H1982R probably damaging Het
Ces5a A T 8: 94,226,059 (GRCm39) S559T unknown Het
Clcf1 A G 19: 4,272,213 (GRCm39) N90S possibly damaging Het
Clec16a G A 16: 10,549,543 (GRCm39) C872Y probably damaging Het
Cobll1 A T 2: 64,933,701 (GRCm39) D430E possibly damaging Het
Cyp1a2 T A 9: 57,589,794 (GRCm39) I7F probably benign Het
Cyp2b23 G A 7: 26,380,848 (GRCm39) R126* probably null Het
Daam2 A G 17: 49,787,782 (GRCm39) W444R possibly damaging Het
Dcbld2 T A 16: 58,275,621 (GRCm39) C446S probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Eif2d T C 1: 131,086,035 (GRCm39) *177R probably null Het
Fkbp15 G A 4: 62,246,114 (GRCm39) A438V probably damaging Het
Gjb5 G A 4: 127,249,652 (GRCm39) A164V probably benign Het
Grin1 A T 2: 25,188,285 (GRCm39) probably null Het
Grm3 A G 5: 9,620,233 (GRCm39) F337S probably damaging Het
Hey2 T A 10: 30,710,019 (GRCm39) T245S probably benign Het
Ifi206 T C 1: 173,308,797 (GRCm39) T400A probably benign Het
Itga7 G A 10: 128,779,902 (GRCm39) E480K probably null Het
Itpr1 T C 6: 108,470,755 (GRCm39) Y2227H possibly damaging Het
Krt8 T C 15: 101,912,337 (GRCm39) D113G probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lins1 A G 7: 66,357,843 (GRCm39) probably benign Het
Lmf1 A T 17: 25,881,610 (GRCm39) D553V possibly damaging Het
Lnpep A G 17: 17,786,992 (GRCm39) S536P probably damaging Het
Lrp1b A T 2: 40,620,716 (GRCm39) C3587* probably null Het
Macf1 A T 4: 123,290,917 (GRCm39) D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 (GRCm39) I251V possibly damaging Het
Myg1 A T 15: 102,245,397 (GRCm39) N206I probably damaging Het
Myl12a T G 17: 71,301,694 (GRCm39) R144S probably benign Het
Myo5a T A 9: 75,055,179 (GRCm39) I454K probably damaging Het
Nwd2 A G 5: 63,965,051 (GRCm39) D1545G probably benign Het
Ogdhl T G 14: 32,061,181 (GRCm39) D457E probably damaging Het
Or5ac20 T A 16: 59,104,704 (GRCm39) D52V probably damaging Het
Or9s18 A C 13: 65,300,588 (GRCm39) L183F probably damaging Het
Paf1 A G 7: 28,095,095 (GRCm39) I112V possibly damaging Het
Pate7 T A 9: 35,689,407 (GRCm39) probably null Het
Pcdhga4 C T 18: 37,819,798 (GRCm39) P449L probably damaging Het
Pla2g6 A T 15: 79,183,342 (GRCm39) I495N possibly damaging Het
Ptgs1 A G 2: 36,127,234 (GRCm39) Y40C probably damaging Het
Rev3l T C 10: 39,700,927 (GRCm39) L1808P possibly damaging Het
Sall2 A G 14: 52,550,586 (GRCm39) S868P probably damaging Het
Shoc1 A T 4: 59,049,017 (GRCm39) M1116K probably benign Het
Slc47a2 A G 11: 61,198,412 (GRCm39) F428L probably benign Het
Slco1a7 C T 6: 141,681,826 (GRCm39) probably null Het
Slco3a1 A T 7: 73,934,363 (GRCm39) F603Y possibly damaging Het
Smyd2 A T 1: 189,642,090 (GRCm39) C65* probably null Het
Ssu72 T C 4: 155,800,007 (GRCm39) F57L probably damaging Het
Tanc2 A G 11: 105,813,709 (GRCm39) T1718A probably benign Het
Tnks G C 8: 35,432,720 (GRCm39) P34A unknown Het
Top3a G A 11: 60,653,348 (GRCm39) T42I probably damaging Het
Trank1 T C 9: 111,220,369 (GRCm39) S2369P probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqln1 T C 13: 58,330,997 (GRCm39) Q410R probably damaging Het
Vmn2r11 A G 5: 109,207,224 (GRCm39) I32T possibly damaging Het
Xcr1 A G 9: 123,685,375 (GRCm39) F129S probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGAATCCTTATGGTCCG -3'
(R):5'- TCCTTCACAGAAGTCAGAAGTAC -3'

Sequencing Primer
(F):5'- CTGGTGGCCAAGAGAAAATTCCTTC -3'
(R):5'- CTTTAGAGTATGTAAGCCTTACCAGG -3'
Posted On 2016-09-01