Incidental Mutation 'R5419:Olfr466'
ID427946
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65152774 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 183 (L183F)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect probably damaging
Transcript: ENSMUST00000058907
AA Change: L183F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: L183F

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214214
AA Change: L183F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4408:Olfr466 UTSW 13 65152700 missense probably benign 0.00
R4625:Olfr466 UTSW 13 65152860 missense possibly damaging 0.95
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7292:Olfr466 UTSW 13 65152842 missense possibly damaging 0.94
R7345:Olfr466 UTSW 13 65152743 missense possibly damaging 0.59
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCACAGAAGCATTTCTCCTGG -3'
(R):5'- CACACGTGGAGAAAGCTTTC -3'

Sequencing Primer
(F):5'- ATGGCCTATGACCGCTTCATTG -3'
(R):5'- AGAAAGCTTTCTGTCGTCCCTG -3'
Posted On2016-09-01