Mutagenetix > Incidental Mutation

Incidental Mutation 'R5419:Sall2'

427948

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

042987-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52313129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 868 (S868P)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: S870P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: S870P

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: S868P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,272,090	L926*	probably null	Het
4931429L15Rik	C	T	9: 46,309,326		probably null	Het
Abca13	T	A	11: 9,193,533		probably null	Het
AI481877	A	T	4: 59,049,017	M1116K	probably benign	Het
Akap13	A	T	7: 75,610,243	T69S	probably benign	Het
Arl1	T	A	10: 88,737,104	C80S	probably damaging	Het
Brsk1	A	G	7: 4,709,004	T618A	possibly damaging	Het
Cep295	T	C	9: 15,324,237	H1982R	probably damaging	Het
Ces5a	A	T	8: 93,499,431	S559T	unknown	Het
Clcf1	A	G	19: 4,222,159	N90S	possibly damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Cobll1	A	T	2: 65,103,357	D430E	possibly damaging	Het
Cyp1a2	T	A	9: 57,682,511	I7F	probably benign	Het
Cyp2b23	G	A	7: 26,681,423	R126*	probably null	Het
Daam2	A	G	17: 49,480,754	W444R	possibly damaging	Het
Dcbld2	T	A	16: 58,455,258	C446S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eif2d	T	C	1: 131,158,298	*177R	probably null	Het
Fkbp15	G	A	4: 62,327,877	A438V	probably damaging	Het
Gjb5	G	A	4: 127,355,859	A164V	probably benign	Het
Gm17727	T	A	9: 35,778,111		probably null	Het
Gm5724	C	T	6: 141,736,100		probably null	Het
Grin1	A	T	2: 25,298,273		probably null	Het
Grm3	A	G	5: 9,570,233	F337S	probably damaging	Het
Hey2	T	A	10: 30,834,023	T245S	probably benign	Het
Ifi206	T	C	1: 173,481,231	T400A	probably benign	Het
Itga7	G	A	10: 128,944,033	E480K	probably null	Het
Itpr1	T	C	6: 108,493,794	Y2227H	possibly damaging	Het
Krt8	T	C	15: 102,003,902	D113G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	A	G	7: 66,708,095		probably benign	Het
Lmf1	A	T	17: 25,662,636	D553V	possibly damaging	Het
Lnpep	A	G	17: 17,566,730	S536P	probably damaging	Het
Lrp1b	A	T	2: 40,730,704	C3587*	probably null	Het
Macf1	A	T	4: 123,397,124	D3435E	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Myg1	A	T	15: 102,336,962	N206I	probably damaging	Het
Myl12a	T	G	17: 70,994,699	R144S	probably benign	Het
Myo5a	T	A	9: 75,147,897	I454K	probably damaging	Het
Nwd2	A	G	5: 63,807,708	D1545G	probably benign	Het
Ogdhl	T	G	14: 32,339,224	D457E	probably damaging	Het
Olfr202	T	A	16: 59,284,341	D52V	probably damaging	Het
Olfr466	A	C	13: 65,152,774	L183F	probably damaging	Het
Paf1	A	G	7: 28,395,670	I112V	possibly damaging	Het
Pcdhga4	C	T	18: 37,686,745	P449L	probably damaging	Het
Pla2g6	A	T	15: 79,299,142	I495N	possibly damaging	Het
Ptgs1	A	G	2: 36,237,222	Y40C	probably damaging	Het
Ptprn2	A	T	12: 117,184,647	I676F	probably damaging	Het
Rev3l	T	C	10: 39,824,931	L1808P	possibly damaging	Het
Slc47a2	A	G	11: 61,307,586	F428L	probably benign	Het
Slco3a1	A	T	7: 74,284,615	F603Y	possibly damaging	Het
Smyd2	A	T	1: 189,909,893	C65*	probably null	Het
Ssu72	T	C	4: 155,715,550	F57L	probably damaging	Het
Tanc2	A	G	11: 105,922,883	T1718A	probably benign	Het
Tnks	G	C	8: 34,965,566	P34A	unknown	Het
Top3a	G	A	11: 60,762,522	T42I	probably damaging	Het
Trank1	T	C	9: 111,391,301	S2369P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqln1	T	C	13: 58,183,183	Q410R	probably damaging	Het
Vmn2r11	A	G	5: 109,059,358	I32T	possibly damaging	Het
Xcr1	A	G	9: 123,856,310	F129S	probably benign	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TGCCTGCAGAAGACACAAGTG -3'
(R):5'- TGGCAACATCAGTAGCAGCAC -3'

Sequencing Primer
(F):5'- AGTGAAGAGTGGCCCATCCTTG -3'
(R):5'- CCCACCACTGTGAAGGAGATG -3'

Posted On

2016-09-01