Incidental Mutation 'R5419:Pla2g6'
ID427949
Institutional Source Beutler Lab
Gene Symbol Pla2g6
Ensembl Gene ENSMUSG00000042632
Gene Namephospholipase A2, group VI
SynonymsiPLA2beta, iPLA2
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79286228-79328390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79299142 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 495 (I495N)
Ref Sequence ENSEMBL: ENSMUSP00000134672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000173163] [ENSMUST00000174021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047816
AA Change: I440N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: I440N

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166977
AA Change: I440N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: I440N

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172403
AA Change: I440N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: I440N

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173163
AA Change: I440N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: I440N

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173412
Predicted Effect possibly damaging
Transcript: ENSMUST00000174021
AA Change: I495N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: I495N

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Blast:ANK 382 411 2e-8 BLAST
Pfam:Patatin 482 666 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174375
Meta Mutation Damage Score 0.9234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Pla2g6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Pla2g6 APN 15 79289241 missense probably damaging 0.96
IGL00906:Pla2g6 APN 15 79287747 missense probably damaging 1.00
IGL01432:Pla2g6 APN 15 79317968 start codon destroyed probably null 1.00
IGL01640:Pla2g6 APN 15 79304313 missense probably benign
IGL01715:Pla2g6 APN 15 79317857 missense probably benign 0.00
IGL01943:Pla2g6 APN 15 79313116 missense probably null 0.00
IGL02551:Pla2g6 APN 15 79299094 missense possibly damaging 0.95
IGL03120:Pla2g6 APN 15 79286860 missense probably damaging 1.00
IGL03193:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03194:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03205:Pla2g6 APN 15 79317785 missense probably damaging 0.98
IGL03289:Pla2g6 APN 15 79317785 missense probably damaging 0.98
R0288:Pla2g6 UTSW 15 79286906 splice site probably benign
R0631:Pla2g6 UTSW 15 79306396 missense probably damaging 1.00
R1216:Pla2g6 UTSW 15 79306435 missense probably benign 0.18
R1617:Pla2g6 UTSW 15 79289141 missense probably benign 0.03
R1785:Pla2g6 UTSW 15 79306345 missense probably benign 0.02
R2025:Pla2g6 UTSW 15 79286764 missense probably damaging 1.00
R2079:Pla2g6 UTSW 15 79312994 missense probably damaging 1.00
R3952:Pla2g6 UTSW 15 79313096 missense probably damaging 1.00
R4774:Pla2g6 UTSW 15 79287618 missense probably damaging 1.00
R4826:Pla2g6 UTSW 15 79308679 missense possibly damaging 0.96
R5093:Pla2g6 UTSW 15 79287128 missense probably benign 0.12
R5327:Pla2g6 UTSW 15 79302637 missense probably benign 0.03
R5390:Pla2g6 UTSW 15 79289693 missense possibly damaging 0.72
R5432:Pla2g6 UTSW 15 79302617 critical splice donor site probably null
R5633:Pla2g6 UTSW 15 79299142 missense possibly damaging 0.82
R5829:Pla2g6 UTSW 15 79287693 missense possibly damaging 0.73
R5930:Pla2g6 UTSW 15 79303528 intron probably benign
R6228:Pla2g6 UTSW 15 79305724 missense probably benign 0.00
R6241:Pla2g6 UTSW 15 79304392 missense probably benign 0.02
R6339:Pla2g6 UTSW 15 79308816 missense probably damaging 0.99
R6485:Pla2g6 UTSW 15 79307372 missense probably benign 0.00
R6754:Pla2g6 UTSW 15 79306310 missense probably benign 0.01
R7425:Pla2g6 UTSW 15 79308733 missense probably damaging 1.00
R7710:Pla2g6 UTSW 15 79287158 missense probably damaging 0.98
R7738:Pla2g6 UTSW 15 79297433 nonsense probably null
R7768:Pla2g6 UTSW 15 79297314 missense probably damaging 1.00
R7796:Pla2g6 UTSW 15 79317825 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GGTAGATGAAGACCACGGATCC -3'
(R):5'- CACATCTGAAGTTTGCCTGC -3'

Sequencing Primer
(F):5'- AGATCTGTCCTCTGCCATGGAAG -3'
(R):5'- CACATCTGAAGTTTGCCTGCTAGTAG -3'
Posted On2016-09-01