Mutagenetix > Incidental Mutations

Incidental Mutation 'R5419:Krt8'

427950

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

MMRRC Submission

042987-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102003902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 113 (D113G)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

probably damaging
Transcript: ENSMUST00000023952
AA Change: D113G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: D113G

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230247

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,272,090	L926*	probably null	Het
4931429L15Rik	C	T	9: 46,309,326		probably null	Het
Abca13	T	A	11: 9,193,533		probably null	Het
AI481877	A	T	4: 59,049,017	M1116K	probably benign	Het
Akap13	A	T	7: 75,610,243	T69S	probably benign	Het
Arl1	T	A	10: 88,737,104	C80S	probably damaging	Het
Brsk1	A	G	7: 4,709,004	T618A	possibly damaging	Het
Cep295	T	C	9: 15,324,237	H1982R	probably damaging	Het
Ces5a	A	T	8: 93,499,431	S559T	unknown	Het
Clcf1	A	G	19: 4,222,159	N90S	possibly damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Cobll1	A	T	2: 65,103,357	D430E	possibly damaging	Het
Cyp1a2	T	A	9: 57,682,511	I7F	probably benign	Het
Cyp2b23	G	A	7: 26,681,423	R126*	probably null	Het
Daam2	A	G	17: 49,480,754	W444R	possibly damaging	Het
Dcbld2	T	A	16: 58,455,258	C446S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eif2d	T	C	1: 131,158,298	*177R	probably null	Het
Fkbp15	G	A	4: 62,327,877	A438V	probably damaging	Het
Gjb5	G	A	4: 127,355,859	A164V	probably benign	Het
Gm17727	T	A	9: 35,778,111		probably null	Het
Gm5724	C	T	6: 141,736,100		probably null	Het
Grin1	A	T	2: 25,298,273		probably null	Het
Grm3	A	G	5: 9,570,233	F337S	probably damaging	Het
Hey2	T	A	10: 30,834,023	T245S	probably benign	Het
Ifi206	T	C	1: 173,481,231	T400A	probably benign	Het
Itga7	G	A	10: 128,944,033	E480K	probably null	Het
Itpr1	T	C	6: 108,493,794	Y2227H	possibly damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	A	G	7: 66,708,095		probably benign	Het
Lmf1	A	T	17: 25,662,636	D553V	possibly damaging	Het
Lnpep	A	G	17: 17,566,730	S536P	probably damaging	Het
Lrp1b	A	T	2: 40,730,704	C3587*	probably null	Het
Macf1	A	T	4: 123,397,124	D3435E	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Myg1	A	T	15: 102,336,962	N206I	probably damaging	Het
Myl12a	T	G	17: 70,994,699	R144S	probably benign	Het
Myo5a	T	A	9: 75,147,897	I454K	probably damaging	Het
Nwd2	A	G	5: 63,807,708	D1545G	probably benign	Het
Ogdhl	T	G	14: 32,339,224	D457E	probably damaging	Het
Olfr202	T	A	16: 59,284,341	D52V	probably damaging	Het
Olfr466	A	C	13: 65,152,774	L183F	probably damaging	Het
Paf1	A	G	7: 28,395,670	I112V	possibly damaging	Het
Pcdhga4	C	T	18: 37,686,745	P449L	probably damaging	Het
Pla2g6	A	T	15: 79,299,142	I495N	possibly damaging	Het
Ptgs1	A	G	2: 36,237,222	Y40C	probably damaging	Het
Ptprn2	A	T	12: 117,184,647	I676F	probably damaging	Het
Rev3l	T	C	10: 39,824,931	L1808P	possibly damaging	Het
Sall2	A	G	14: 52,313,129	S868P	probably damaging	Het
Slc47a2	A	G	11: 61,307,586	F428L	probably benign	Het
Slco3a1	A	T	7: 74,284,615	F603Y	possibly damaging	Het
Smyd2	A	T	1: 189,909,893	C65*	probably null	Het
Ssu72	T	C	4: 155,715,550	F57L	probably damaging	Het
Tanc2	A	G	11: 105,922,883	T1718A	probably benign	Het
Tnks	G	C	8: 34,965,566	P34A	unknown	Het
Top3a	G	A	11: 60,762,522	T42I	probably damaging	Het
Trank1	T	C	9: 111,391,301	S2369P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqln1	T	C	13: 58,183,183	Q410R	probably damaging	Het
Vmn2r11	A	G	5: 109,059,358	I32T	possibly damaging	Het
Xcr1	A	G	9: 123,856,310	F129S	probably benign	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2258:Krt8	UTSW	15	101998822	missense	probably benign
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R5997:Krt8	UTSW	15	102000594	missense	possibly damaging	0.77
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R6875:Krt8	UTSW	15	101997908	missense	probably benign	0.44
R7650:Krt8	UTSW	15	102004163	missense	probably benign	0.07
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R8826:Krt8	UTSW	15	102001435	missense	possibly damaging	0.89
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTAGTCACAAGCACTTCAGACC -3'
(R):5'- TACAAGATGTCCACCTCCGG -3'

Sequencing Primer
(F):5'- AGCACTTCAGACCCTCTGG -3'
(R):5'- TCGTTCACGAGTGGACCC -3'

Posted On

2016-09-01