Incidental Mutation 'R5419:Krt8'
ID 427950
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5419 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102003902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect probably damaging
Transcript: ENSMUST00000023952
AA Change: D113G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: D113G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230247
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGTCACAAGCACTTCAGACC -3'
(R):5'- TACAAGATGTCCACCTCCGG -3'

Sequencing Primer
(F):5'- AGCACTTCAGACCCTCTGG -3'
(R):5'- TCGTTCACGAGTGGACCC -3'
Posted On 2016-09-01