Incidental Mutation 'R5419:Lnpep'
ID427955
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17566730 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 536 (S536P)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect probably damaging
Transcript: ENSMUST00000041047
AA Change: S536P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: S536P

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17579027 missense probably benign 0.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7013:Lnpep UTSW 17 17568363 missense probably benign 0.04
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
R7564:Lnpep UTSW 17 17578592 missense probably benign 0.22
R7746:Lnpep UTSW 17 17538562 missense probably benign
R7853:Lnpep UTSW 17 17562847 missense probably benign 0.00
R7881:Lnpep UTSW 17 17566739 missense probably benign 0.01
R8015:Lnpep UTSW 17 17546499 missense probably damaging 1.00
R8070:Lnpep UTSW 17 17538638 missense probably damaging 1.00
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACTGACTAAAAGGGAGAC -3'
(R):5'- ATGCCTCAGTTCTCAGTGCC -3'

Sequencing Primer
(F):5'- CAAACGTTAAGACCAAACAGATTTAC -3'
(R):5'- GCCGTTTTAAGCTTAAGGAACTGC -3'
Posted On2016-09-01