Incidental Mutation 'R5419:Lmf1'
ID427956
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25662636 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 553 (D553V)
Ref Sequence ENSEMBL: ENSMUSP00000066682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063344
AA Change: D553V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: D553V

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116641
AA Change: D553V

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: D553V

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACACACCCTGGTAGGATGAG -3'
(R):5'- CTCCACAACAGGGAAGGGTTAG -3'

Sequencing Primer
(F):5'- CCCTGGTAGGATGAGGTGGAG -3'
(R):5'- GGAAGCACATCCTTTTCCAATC -3'
Posted On2016-09-01