Mutagenetix > Incidental Mutations

Incidental Mutation 'R5419:Lmf1'

427956

Institutional Source

Beutler Lab

Gene Symbol

Lmf1

Ensembl Gene

ENSMUSG00000002279

Gene Name

lipase maturation factor 1

Synonyms

Tmem112, 2400010G15Rik

MMRRC Submission

042987-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25579174-25662826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25662636 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 553 (D553V)

Ref Sequence

ENSEMBL: ENSMUSP00000066682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063344
AA Change: D553V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: D553V

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
transmembrane domain	97	119	N/A	INTRINSIC
transmembrane domain	129	151	N/A	INTRINSIC
Pfam:LMF1	169	551	2.3e-142	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000116641
AA Change: D553V

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: D553V

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
transmembrane domain	97	119	N/A	INTRINSIC
transmembrane domain	129	151	N/A	INTRINSIC
Pfam:LMF1	169	553	1.2e-148	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137201

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,272,090	L926*	probably null	Het
4931429L15Rik	C	T	9: 46,309,326		probably null	Het
Abca13	T	A	11: 9,193,533		probably null	Het
AI481877	A	T	4: 59,049,017	M1116K	probably benign	Het
Akap13	A	T	7: 75,610,243	T69S	probably benign	Het
Arl1	T	A	10: 88,737,104	C80S	probably damaging	Het
Brsk1	A	G	7: 4,709,004	T618A	possibly damaging	Het
Cep295	T	C	9: 15,324,237	H1982R	probably damaging	Het
Ces5a	A	T	8: 93,499,431	S559T	unknown	Het
Clcf1	A	G	19: 4,222,159	N90S	possibly damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Cobll1	A	T	2: 65,103,357	D430E	possibly damaging	Het
Cyp1a2	T	A	9: 57,682,511	I7F	probably benign	Het
Cyp2b23	G	A	7: 26,681,423	R126*	probably null	Het
Daam2	A	G	17: 49,480,754	W444R	possibly damaging	Het
Dcbld2	T	A	16: 58,455,258	C446S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eif2d	T	C	1: 131,158,298	*177R	probably null	Het
Fkbp15	G	A	4: 62,327,877	A438V	probably damaging	Het
Gjb5	G	A	4: 127,355,859	A164V	probably benign	Het
Gm17727	T	A	9: 35,778,111		probably null	Het
Gm5724	C	T	6: 141,736,100		probably null	Het
Grin1	A	T	2: 25,298,273		probably null	Het
Grm3	A	G	5: 9,570,233	F337S	probably damaging	Het
Hey2	T	A	10: 30,834,023	T245S	probably benign	Het
Ifi206	T	C	1: 173,481,231	T400A	probably benign	Het
Itga7	G	A	10: 128,944,033	E480K	probably null	Het
Itpr1	T	C	6: 108,493,794	Y2227H	possibly damaging	Het
Krt8	T	C	15: 102,003,902	D113G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	A	G	7: 66,708,095		probably benign	Het
Lnpep	A	G	17: 17,566,730	S536P	probably damaging	Het
Lrp1b	A	T	2: 40,730,704	C3587*	probably null	Het
Macf1	A	T	4: 123,397,124	D3435E	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Myg1	A	T	15: 102,336,962	N206I	probably damaging	Het
Myl12a	T	G	17: 70,994,699	R144S	probably benign	Het
Myo5a	T	A	9: 75,147,897	I454K	probably damaging	Het
Nwd2	A	G	5: 63,807,708	D1545G	probably benign	Het
Ogdhl	T	G	14: 32,339,224	D457E	probably damaging	Het
Olfr202	T	A	16: 59,284,341	D52V	probably damaging	Het
Olfr466	A	C	13: 65,152,774	L183F	probably damaging	Het
Paf1	A	G	7: 28,395,670	I112V	possibly damaging	Het
Pcdhga4	C	T	18: 37,686,745	P449L	probably damaging	Het
Pla2g6	A	T	15: 79,299,142	I495N	possibly damaging	Het
Ptgs1	A	G	2: 36,237,222	Y40C	probably damaging	Het
Ptprn2	A	T	12: 117,184,647	I676F	probably damaging	Het
Rev3l	T	C	10: 39,824,931	L1808P	possibly damaging	Het
Sall2	A	G	14: 52,313,129	S868P	probably damaging	Het
Slc47a2	A	G	11: 61,307,586	F428L	probably benign	Het
Slco3a1	A	T	7: 74,284,615	F603Y	possibly damaging	Het
Smyd2	A	T	1: 189,909,893	C65*	probably null	Het
Ssu72	T	C	4: 155,715,550	F57L	probably damaging	Het
Tanc2	A	G	11: 105,922,883	T1718A	probably benign	Het
Tnks	G	C	8: 34,965,566	P34A	unknown	Het
Top3a	G	A	11: 60,762,522	T42I	probably damaging	Het
Trank1	T	C	9: 111,391,301	S2369P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqln1	T	C	13: 58,183,183	Q410R	probably damaging	Het
Vmn2r11	A	G	5: 109,059,358	I32T	possibly damaging	Het
Xcr1	A	G	9: 123,856,310	F129S	probably benign	Het

Other mutations in Lmf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03153:Lmf1	APN	17	25585650	missense	possibly damaging	0.51
R0117:Lmf1	UTSW	17	25655991	unclassified	probably benign
R1757:Lmf1	UTSW	17	25655210	missense	probably damaging	1.00
R1906:Lmf1	UTSW	17	25612335	missense	probably damaging	0.99
R2389:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R2446:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3797:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3798:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3855:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3953:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3955:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R3956:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R4290:Lmf1	UTSW	17	25654481	missense	probably damaging	1.00
R4291:Lmf1	UTSW	17	25654481	missense	probably damaging	1.00
R4293:Lmf1	UTSW	17	25654481	missense	probably damaging	1.00
R4636:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R4698:Lmf1	UTSW	17	25579350	missense	probably damaging	0.98
R4791:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R4792:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R4968:Lmf1	UTSW	17	25585618	missense	probably damaging	1.00
R4997:Lmf1	UTSW	17	25588676	nonsense	probably null
R5047:Lmf1	UTSW	17	25631838	intron	probably benign
R5152:Lmf1	UTSW	17	25655519	missense	probably damaging	0.99
R6162:Lmf1	UTSW	17	25612394	missense	probably benign	0.00
R6693:Lmf1	UTSW	17	25645278	missense	probably benign	0.00
R7583:Lmf1	UTSW	17	25655449	missense
R7642:Lmf1	UTSW	17	25654471	missense	probably damaging	1.00
R7667:Lmf1	UTSW	17	25654608	critical splice donor site	probably null
R7671:Lmf1	UTSW	17	25579349	missense	possibly damaging	0.75
R7818:Lmf1	UTSW	17	25662591	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- ACACACCCTGGTAGGATGAG -3'
(R):5'- CTCCACAACAGGGAAGGGTTAG -3'

Sequencing Primer
(F):5'- CCCTGGTAGGATGAGGTGGAG -3'
(R):5'- GGAAGCACATCCTTTTCCAATC -3'

Posted On

2016-09-01