Incidental Mutation 'R5420:Fmn2'
ID 427965
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Name formin 2
Synonyms
MMRRC Submission 042988-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.816) question?
Stock # R5420 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 174329391-174650295 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 174526344 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1388 (R1388*)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
AlphaFold Q9JL04
Predicted Effect probably null
Transcript: ENSMUST00000030039
AA Change: R1388*
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: R1388*

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191971
Predicted Effect probably benign
Transcript: ENSMUST00000195621
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,915,372 (GRCm39) probably null Het
Adamts1 A T 16: 85,596,497 (GRCm39) C117* probably null Het
Adgrg6 A T 10: 14,302,730 (GRCm39) Y894* probably null Het
Alas1 G T 9: 106,111,358 (GRCm39) L603I probably benign Het
Arhgap21 G T 2: 20,885,897 (GRCm39) R427S probably damaging Het
Arhgef25 A T 10: 127,023,143 (GRCm39) V88D probably benign Het
Bdp1 T C 13: 100,202,551 (GRCm39) Q691R possibly damaging Het
Bpifa6 T A 2: 153,831,250 (GRCm39) I272N probably damaging Het
Cacybp T C 1: 160,035,914 (GRCm39) probably benign Het
Capn3 T C 2: 120,325,777 (GRCm39) probably benign Het
Ccdc47 C T 11: 106,101,176 (GRCm39) R162Q probably benign Het
Cideb A C 14: 55,995,748 (GRCm39) M1R probably null Het
Clec16a G A 16: 10,549,543 (GRCm39) C872Y probably damaging Het
Crebbp C T 16: 3,925,322 (GRCm39) R760H probably damaging Het
Cyp2c23 A C 19: 44,004,103 (GRCm39) probably null Het
Cyp3a13 T G 5: 137,897,243 (GRCm39) D357A probably damaging Het
Dip2b C T 15: 100,103,054 (GRCm39) probably benign Het
Ecm2 A T 13: 49,681,210 (GRCm39) R448S possibly damaging Het
Edil3 T C 13: 89,279,891 (GRCm39) Y190H probably damaging Het
Eps8l1 T G 7: 4,473,160 (GRCm39) probably null Het
Eps8l3 A T 3: 107,791,301 (GRCm39) K280* probably null Het
Fam184a A G 10: 53,509,753 (GRCm39) F1137L probably damaging Het
Glt8d2 T C 10: 82,488,516 (GRCm39) K318R probably benign Het
Herc2 A T 7: 55,853,578 (GRCm39) K3690I probably damaging Het
Ifi206 T A 1: 173,308,599 (GRCm39) I466F possibly damaging Het
Jade2 T C 11: 51,709,434 (GRCm39) K525R probably benign Het
Kmt2a A T 9: 44,759,633 (GRCm39) F772I probably damaging Het
Lipi A G 16: 75,352,757 (GRCm39) V360A possibly damaging Het
Mbl1 C T 14: 40,879,153 (GRCm39) S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 (GRCm39) I251V possibly damaging Het
Mrpl23 A G 7: 142,089,874 (GRCm39) T25A probably damaging Het
Mto1 T A 9: 78,360,109 (GRCm39) M199K probably benign Het
Nes A T 3: 87,884,309 (GRCm39) N812I probably damaging Het
Nfkbie T A 17: 45,871,132 (GRCm39) D261E probably benign Het
Or7e173 T C 9: 19,938,355 (GRCm39) Y293C probably damaging Het
Pakap G A 4: 57,856,062 (GRCm39) V505I probably benign Het
Pakap T A 4: 57,856,434 (GRCm39) Y588N probably damaging Het
Papola A G 12: 105,772,754 (GRCm39) I114V possibly damaging Het
Pappa T G 4: 65,254,017 (GRCm39) probably null Het
Pcdh7 T A 5: 57,877,529 (GRCm39) D361E probably damaging Het
Pick1 A G 15: 79,133,040 (GRCm39) T367A probably benign Het
Plbd2 A G 5: 120,632,547 (GRCm39) Y152H probably damaging Het
Ppfia2 A T 10: 106,671,562 (GRCm39) E424D possibly damaging Het
Rab7b C T 1: 131,626,164 (GRCm39) T64I probably damaging Het
Rarb T A 14: 16,434,249 (GRCm38) I310F possibly damaging Het
Rdh16f2 C T 10: 127,712,943 (GRCm39) P314S possibly damaging Het
Rpain A T 11: 70,868,516 (GRCm39) probably null Het
Rufy3 T C 5: 88,788,518 (GRCm39) *488Q probably null Het
Sash1 G A 10: 8,621,950 (GRCm39) T398I probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Scrn1 T A 6: 54,489,048 (GRCm39) I358F probably benign Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Thbs1 G T 2: 117,943,636 (GRCm39) D85Y possibly damaging Het
Thoc2l T A 5: 104,666,225 (GRCm39) I249N probably damaging Het
Trp53 T C 11: 69,479,146 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,433,675 (GRCm39) R90G probably benign Het
Zfp521 A T 18: 13,977,144 (GRCm39) Y1090N probably damaging Het
Zfp677 T C 17: 21,618,175 (GRCm39) C411R probably damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174,330,885 (GRCm39) missense unknown
IGL01085:Fmn2 APN 1 174,523,220 (GRCm39) missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174,329,994 (GRCm39) missense unknown
IGL02095:Fmn2 APN 1 174,330,167 (GRCm39) missense unknown
IGL02330:Fmn2 APN 1 174,437,511 (GRCm39) missense probably benign 0.38
IGL02552:Fmn2 APN 1 174,523,286 (GRCm39) missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174,409,625 (GRCm39) missense unknown
PIT4498001:Fmn2 UTSW 1 174,440,170 (GRCm39) missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174,474,699 (GRCm39) missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174,618,880 (GRCm39) missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0306:Fmn2 UTSW 1 174,437,050 (GRCm39) unclassified probably benign
R0325:Fmn2 UTSW 1 174,437,520 (GRCm39) critical splice donor site probably null
R0403:Fmn2 UTSW 1 174,521,844 (GRCm39) missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174,409,525 (GRCm39) missense unknown
R0898:Fmn2 UTSW 1 174,331,026 (GRCm39) missense unknown
R1202:Fmn2 UTSW 1 174,440,101 (GRCm39) nonsense probably null
R1719:Fmn2 UTSW 1 174,436,024 (GRCm39) unclassified probably benign
R1763:Fmn2 UTSW 1 174,329,832 (GRCm39) missense unknown
R1771:Fmn2 UTSW 1 174,436,342 (GRCm39) unclassified probably benign
R1777:Fmn2 UTSW 1 174,409,488 (GRCm39) missense unknown
R1831:Fmn2 UTSW 1 174,437,511 (GRCm39) missense probably benign 0.38
R2259:Fmn2 UTSW 1 174,330,498 (GRCm39) missense unknown
R2960:Fmn2 UTSW 1 174,437,385 (GRCm39) missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174,330,192 (GRCm39) missense unknown
R3840:Fmn2 UTSW 1 174,409,599 (GRCm39) frame shift probably null
R4207:Fmn2 UTSW 1 174,409,521 (GRCm39) missense unknown
R4679:Fmn2 UTSW 1 174,330,728 (GRCm39) missense unknown
R4779:Fmn2 UTSW 1 174,437,461 (GRCm39) missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174,409,527 (GRCm39) missense unknown
R4926:Fmn2 UTSW 1 174,329,981 (GRCm39) missense unknown
R5007:Fmn2 UTSW 1 174,571,866 (GRCm39) missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174,648,794 (GRCm39) missense probably benign 0.04
R5324:Fmn2 UTSW 1 174,436,446 (GRCm39) unclassified probably benign
R5353:Fmn2 UTSW 1 174,330,572 (GRCm39) missense unknown
R5607:Fmn2 UTSW 1 174,437,377 (GRCm39) missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174,409,603 (GRCm39) missense unknown
R5982:Fmn2 UTSW 1 174,330,019 (GRCm39) missense unknown
R6148:Fmn2 UTSW 1 174,494,229 (GRCm39) missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174,440,119 (GRCm39) missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174,437,149 (GRCm39) unclassified probably benign
R6647:Fmn2 UTSW 1 174,420,670 (GRCm39) missense unknown
R6835:Fmn2 UTSW 1 174,527,235 (GRCm39) missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7340:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7378:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7457:Fmn2 UTSW 1 174,331,303 (GRCm39) splice site probably null
R7474:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7564:Fmn2 UTSW 1 174,437,140 (GRCm39) missense unknown
R7582:Fmn2 UTSW 1 174,526,356 (GRCm39) missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174,494,215 (GRCm39) missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8035:Fmn2 UTSW 1 174,547,437 (GRCm39) missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8343:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8371:Fmn2 UTSW 1 174,437,173 (GRCm39) missense unknown
R8377:Fmn2 UTSW 1 174,436,011 (GRCm39) nonsense probably null
R8543:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8724:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8726:Fmn2 UTSW 1 174,437,404 (GRCm39) missense possibly damaging 0.86
R8891:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R9074:Fmn2 UTSW 1 174,436,198 (GRCm39) missense unknown
R9167:Fmn2 UTSW 1 174,331,056 (GRCm39) missense unknown
R9489:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9598:Fmn2 UTSW 1 174,436,308 (GRCm39) missense unknown
R9605:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9698:Fmn2 UTSW 1 174,364,739 (GRCm39) missense unknown
RF010:Fmn2 UTSW 1 174,409,581 (GRCm39) missense unknown
Z1176:Fmn2 UTSW 1 174,435,960 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AACATTCTGTCATCCAGCCC -3'
(R):5'- TCACATGCATGCATTATACTGC -3'

Sequencing Primer
(F):5'- TGTCATCCAGCCCTTTAGATACAAGG -3'
(R):5'- GCATGCATTATACTGCTATACACAC -3'
Posted On 2016-09-01