Incidental Mutation 'R5420:Arhgap21'
ID427966
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20881086 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 427 (R427S)
Ref Sequence ENSEMBL: ENSMUSP00000133851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114594
AA Change: R431S

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: R431S

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141298
AA Change: R437S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: R437S

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154230
AA Change: R437S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: R437S

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: R427S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: R427S

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174584
AA Change: R266S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: R266S

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
R7965:Arhgap21 UTSW 2 20849196 missense probably damaging 1.00
R7986:Arhgap21 UTSW 2 20863156 missense probably damaging 1.00
R8028:Arhgap21 UTSW 2 20880405 missense probably benign 0.02
R8209:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8226:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8251:Arhgap21 UTSW 2 20849410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCACGAACGAGTTCTATG -3'
(R):5'- AGATCACAAGCCGTGGATTCC -3'

Sequencing Primer
(F):5'- CCCACGAACGAGTTCTATGATTATTG -3'
(R):5'- GTCTGTCAATCACTACTCTGCAAAC -3'
Posted On2016-09-01