Incidental Mutation 'R5420:Cyp3a13'
ID427981
Institutional Source Beutler Lab
Gene Symbol Cyp3a13
Ensembl Gene ENSMUSG00000029727
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 13
Synonymssteroid inducible, IIIAm2
MMRRC Submission 042988-MU
Accession Numbers

Genbank: NM_007819

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137892932-137921619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 137898981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 357 (D357A)
Ref Sequence ENSEMBL: ENSMUSP00000031741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031741]
Predicted Effect probably damaging
Transcript: ENSMUST00000031741
AA Change: D357A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031741
Gene: ENSMUSG00000029727
AA Change: D357A

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:p450 38 493 1.3e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121449
Meta Mutation Damage Score 0.6784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent alterations in hematology, plasma clinical chemistry or pathology. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Cyp3a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Cyp3a13 APN 5 137911933 missense probably benign 0.08
IGL01879:Cyp3a13 APN 5 137919003 missense probably benign
IGL01886:Cyp3a13 APN 5 137898820 missense probably damaging 1.00
IGL02048:Cyp3a13 APN 5 137918995 splice site probably benign
IGL02102:Cyp3a13 APN 5 137911603 missense probably benign 0.00
IGL02285:Cyp3a13 APN 5 137909967 missense probably benign 0.38
IGL03213:Cyp3a13 APN 5 137894267 utr 3 prime probably benign
IGL03238:Cyp3a13 APN 5 137898889 missense probably damaging 0.99
G4846:Cyp3a13 UTSW 5 137898823 missense possibly damaging 0.55
IGL02988:Cyp3a13 UTSW 5 137899010 nonsense probably null
PIT4486001:Cyp3a13 UTSW 5 137909966 missense probably benign 0.17
R0319:Cyp3a13 UTSW 5 137898862 missense probably damaging 1.00
R1024:Cyp3a13 UTSW 5 137894364 missense possibly damaging 0.56
R1189:Cyp3a13 UTSW 5 137911630 splice site probably null
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1501:Cyp3a13 UTSW 5 137911630 splice site probably null
R1838:Cyp3a13 UTSW 5 137911632 splice site probably null
R1956:Cyp3a13 UTSW 5 137909942 missense probably benign 0.02
R1981:Cyp3a13 UTSW 5 137911856 missense probably damaging 0.97
R2048:Cyp3a13 UTSW 5 137909975 missense probably damaging 0.98
R2140:Cyp3a13 UTSW 5 137921454 missense possibly damaging 0.93
R4844:Cyp3a13 UTSW 5 137917551 missense probably benign
R5001:Cyp3a13 UTSW 5 137898916 missense probably benign 0.00
R5062:Cyp3a13 UTSW 5 137898899 missense possibly damaging 0.52
R5855:Cyp3a13 UTSW 5 137919056 missense probably damaging 0.98
R6089:Cyp3a13 UTSW 5 137909953 missense probably benign 0.07
R6927:Cyp3a13 UTSW 5 137895284 missense probably damaging 1.00
R6978:Cyp3a13 UTSW 5 137905539 missense probably benign 0.01
R7283:Cyp3a13 UTSW 5 137905556 missense probably benign 0.01
R7571:Cyp3a13 UTSW 5 137898863 missense possibly damaging 0.93
R7781:Cyp3a13 UTSW 5 137898874 missense possibly damaging 0.94
R8281:Cyp3a13 UTSW 5 137894297 missense probably benign 0.01
RF007:Cyp3a13 UTSW 5 137894263 makesense probably null
RF020:Cyp3a13 UTSW 5 137894263 makesense probably null
X0024:Cyp3a13 UTSW 5 137900391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTCAGGGCGGAATTCC -3'
(R):5'- CCTGGGTTTGTAATTGTCACAAAG -3'

Sequencing Primer
(F):5'- TTCAGGGCGGAATTCCTCAGG -3'
(R):5'- ACATTGATCACATTGAAGTATGTCAG -3'
Posted On2016-09-01