Incidental Mutation 'R5420:Glt8d2'
ID427996
Institutional Source Beutler Lab
Gene Symbol Glt8d2
Ensembl Gene ENSMUSG00000020251
Gene Nameglycosyltransferase 8 domain containing 2
Synonyms1110021D20Rik
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location82650433-82690650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82652682 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 318 (K318R)
Ref Sequence ENSEMBL: ENSMUSP00000069188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020485] [ENSMUST00000065815] [ENSMUST00000092266] [ENSMUST00000125505] [ENSMUST00000151390] [ENSMUST00000177353]
Predicted Effect probably benign
Transcript: ENSMUST00000020485
SMART Domains Protein: ENSMUSP00000020485
Gene: ENSMUSG00000020251

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glyco_transf_8 54 326 3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065815
AA Change: K318R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069188
Gene: ENSMUSG00000020251
AA Change: K318R

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
Pfam:Glyco_transf_8 54 312 2.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092266
SMART Domains Protein: ENSMUSP00000089917
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
internal_repeat_1 3 21 1.82e-5 PROSPERO
internal_repeat_1 18 36 1.82e-5 PROSPERO
low complexity region 39 57 N/A INTRINSIC
low complexity region 63 84 N/A INTRINSIC
UDG 112 278 2.03e0 SMART
UreE_C 112 278 2.03e0 SMART
low complexity region 324 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142658
Predicted Effect probably benign
Transcript: ENSMUST00000150269
Predicted Effect probably benign
Transcript: ENSMUST00000151390
SMART Domains Protein: ENSMUSP00000121000
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
internal_repeat_1 23 45 8.83e-7 PROSPERO
internal_repeat_1 38 60 8.83e-7 PROSPERO
low complexity region 63 81 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
UDG 136 302 1.6e-4 SMART
UreE_C 136 302 1.6e-4 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176195
Predicted Effect probably benign
Transcript: ENSMUST00000176326
SMART Domains Protein: ENSMUSP00000135009
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
Blast:UreE_C 2 78 9e-50 BLAST
SCOP:d1muga_ 2 83 2e-10 SMART
PDB:2D07|A 2 123 9e-85 PDB
low complexity region 124 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177353
SMART Domains Protein: ENSMUSP00000135621
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
UDG 28 185 9.44e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show reduced viability and a decreased serum immunoglobulin response to antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Glt8d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Glt8d2 APN 10 82651513 missense possibly damaging 0.83
IGL00848:Glt8d2 APN 10 82662165 critical splice donor site probably null
IGL01479:Glt8d2 APN 10 82660736 missense probably damaging 1.00
IGL03185:Glt8d2 APN 10 82662276 missense probably damaging 1.00
vitus UTSW 10 82664713 missense possibly damaging 0.54
R0139:Glt8d2 UTSW 10 82660810 missense probably damaging 1.00
R0255:Glt8d2 UTSW 10 82651527 unclassified probably null
R0464:Glt8d2 UTSW 10 82654730 missense possibly damaging 0.81
R0483:Glt8d2 UTSW 10 82662153 unclassified probably benign
R0789:Glt8d2 UTSW 10 82664685 missense probably damaging 1.00
R1496:Glt8d2 UTSW 10 82659538 missense probably damaging 0.98
R1930:Glt8d2 UTSW 10 82664642 missense probably benign 0.00
R3715:Glt8d2 UTSW 10 82652737 missense probably benign 0.00
R4493:Glt8d2 UTSW 10 82664713 missense possibly damaging 0.54
R4707:Glt8d2 UTSW 10 82660749 missense probably damaging 1.00
R4785:Glt8d2 UTSW 10 82660749 missense probably damaging 1.00
R4886:Glt8d2 UTSW 10 82652040 unclassified probably benign
R5485:Glt8d2 UTSW 10 82651448 missense possibly damaging 0.79
R5859:Glt8d2 UTSW 10 82672081 start codon destroyed probably null
R6416:Glt8d2 UTSW 10 82652906 missense probably damaging 1.00
R7527:Glt8d2 UTSW 10 82652569 missense unknown
R7563:Glt8d2 UTSW 10 82660825 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCGCAAGATGGAAGTTCTATGCTG -3'
(R):5'- ACCTCGGTAAGTCCTTCCAG -3'

Sequencing Primer
(F):5'- GCTGAGCATCACTCTGTAAGC -3'
(R):5'- TCCTTCCAGGAAGCAGGG -3'
Posted On2016-09-01