Incidental Mutation 'R5420:Ppfia2'
ID427997
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106835701 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 424 (E424D)
Ref Sequence ENSEMBL: ENSMUSP00000029404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029404
AA Change: E424D

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: E424D

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217854
AA Change: E424D

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106830659 missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106865403 critical splice donor site probably null
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGTGTTCTGCTGATGC -3'
(R):5'- GCAAATGATGTCAGCACAGCTTC -3'

Sequencing Primer
(F):5'- AACAGGCCCTTGTTAGCTGAC -3'
(R):5'- CTTCTAGCAGGGGATGTTTTCC -3'
Posted On2016-09-01