Mutagenetix > Incidental Mutation

Incidental Mutation 'R5420:Bdp1'

428010

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

042988-MU

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5420 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100066043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 691 (Q691R)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038104
AA Change: Q691R

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: Q691R

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109379
AA Change: Q691R

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: Q691R

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167815

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	TGCGCAGC	T	19: 4,865,344		probably null	Het
Adamts1	A	T	16: 85,799,609	C117*	probably null	Het
Adgrg6	A	T	10: 14,426,986	Y894*	probably null	Het
Akap2	G	A	4: 57,856,062	V505I	probably benign	Het
Akap2	T	A	4: 57,856,434	Y588N	probably damaging	Het
Alas1	G	T	9: 106,234,159	L603I	probably benign	Het
Arhgap21	G	T	2: 20,881,086	R427S	probably damaging	Het
Arhgef25	A	T	10: 127,187,274	V88D	probably benign	Het
BC005561	T	A	5: 104,518,359	I249N	probably damaging	Het
Bpifa6	T	A	2: 153,989,330	I272N	probably damaging	Het
Cacybp	T	C	1: 160,208,344		probably benign	Het
Capn3	T	C	2: 120,495,296		probably benign	Het
Ccdc47	C	T	11: 106,210,350	R162Q	probably benign	Het
Cideb	A	C	14: 55,758,291	M1R	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Crebbp	C	T	16: 4,107,458	R760H	probably damaging	Het
Cyp2c23	A	C	19: 44,015,664		probably null	Het
Cyp3a13	T	G	5: 137,898,981	D357A	probably damaging	Het
Dip2b	C	T	15: 100,205,173		probably benign	Het
Ecm2	A	T	13: 49,527,734	R448S	possibly damaging	Het
Edil3	T	C	13: 89,131,772	Y190H	probably damaging	Het
Eps8l1	T	G	7: 4,470,161		probably null	Het
Eps8l3	A	T	3: 107,883,985	K280*	probably null	Het
Fam184a	A	G	10: 53,633,657	F1137L	probably damaging	Het
Fmn2	A	T	1: 174,698,778	R1388*	probably null	Het
Glt8d2	T	C	10: 82,652,682	K318R	probably benign	Het
Herc2	A	T	7: 56,203,830	K3690I	probably damaging	Het
Ifi206	T	A	1: 173,481,033	I466F	possibly damaging	Het
Jade2	T	C	11: 51,818,607	K525R	probably benign	Het
Kmt2a	A	T	9: 44,848,336	F772I	probably damaging	Het
Lipi	A	G	16: 75,555,869	V360A	possibly damaging	Het
Mbl1	C	T	14: 41,157,196	S108L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Mrpl23	A	G	7: 142,536,137	T25A	probably damaging	Het
Mto1	T	A	9: 78,452,827	M199K	probably benign	Het
Nes	A	T	3: 87,977,002	N812I	probably damaging	Het
Nfkbie	T	A	17: 45,560,206	D261E	probably benign	Het
Olfr866	T	C	9: 20,027,059	Y293C	probably damaging	Het
Papola	A	G	12: 105,806,495	I114V	possibly damaging	Het
Pappa	T	G	4: 65,335,780		probably null	Het
Pcdh7	T	A	5: 57,720,187	D361E	probably damaging	Het
Pick1	A	G	15: 79,248,840	T367A	probably benign	Het
Plbd2	A	G	5: 120,494,482	Y152H	probably damaging	Het
Ppfia2	A	T	10: 106,835,701	E424D	possibly damaging	Het
Rab7b	C	T	1: 131,698,426	T64I	probably damaging	Het
Rarb	T	A	14: 16,434,249	I310F	possibly damaging	Het
Rdh16f2	C	T	10: 127,877,074	P314S	possibly damaging	Het
Rpain	A	T	11: 70,977,690		probably null	Het
Rufy3	T	C	5: 88,640,659	*488Q	probably null	Het
Sash1	G	A	10: 8,746,186	T398I	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scrn1	T	A	6: 54,512,063	I358F	probably benign	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Thbs1	G	T	2: 118,113,155	D85Y	possibly damaging	Het
Trp53	T	C	11: 69,588,320		probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r223	A	G	13: 23,249,505	R90G	probably benign	Het
Zfp521	A	T	18: 13,844,087	Y1090N	probably damaging	Het
Zfp677	T	C	17: 21,397,913	C411R	probably damaging	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGAGTCATGCACAATGCTC -3'
(R):5'- GCCTTCAAGAGTAAAGTGTGC -3'

Sequencing Primer
(F):5'- GAGTCATGCACAATGCTCAAATATC -3'
(R):5'- CCTTCAAGAGTAAAGTGTGCATGTG -3'

Posted On

2016-09-01