Incidental Mutation 'R5420:Pick1'
ID428015
Institutional Source Beutler Lab
Gene Symbol Pick1
Ensembl Gene ENSMUSG00000116121
Gene Name
SynonymsPrkcabp
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79229391-79256674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79248840 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000129468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018295] [ENSMUST00000039752] [ENSMUST00000053926] [ENSMUST00000163571] [ENSMUST00000166155]
Predicted Effect probably benign
Transcript: ENSMUST00000018295
AA Change: T367A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000018295
Gene: ENSMUSG00000068206
AA Change: T367A

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039752
SMART Domains Protein: ENSMUSP00000040522
Gene: ENSMUSG00000032988

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:MFS_1 20 349 1.3e-28 PFAM
transmembrane domain 353 372 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053926
SMART Domains Protein: ENSMUSP00000061125
Gene: ENSMUSG00000116121

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 363 1.18e-103 SMART
GLECT 393 530 7.99e-3 SMART
Gal-bind_lectin 399 530 4.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113954
Predicted Effect probably benign
Transcript: ENSMUST00000163571
AA Change: T367A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128126
Gene: ENSMUSG00000068206
AA Change: T367A

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165609
Predicted Effect probably benign
Transcript: ENSMUST00000166155
AA Change: T367A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129468
Gene: ENSMUSG00000068206
AA Change: T367A

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230477
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show impaired synaptic plasticity and lack of long-term depression; males are infertile due to reduced sperm count and impaired sperm motility, and display small testes and seminiferous tubules, malformed acrosomes, globozoospermia, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Pick1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pick1 APN 15 79247257 splice site probably benign
IGL03137:Pick1 APN 15 79245301 missense possibly damaging 0.61
IGL03366:Pick1 APN 15 79241281 missense probably damaging 0.97
FR4976:Pick1 UTSW 15 79255946 frame shift probably null
R1590:Pick1 UTSW 15 79245301 missense probably benign 0.40
R2114:Pick1 UTSW 15 79255581 unclassified probably benign
R2115:Pick1 UTSW 15 79255581 unclassified probably benign
R2219:Pick1 UTSW 15 79239699 missense probably damaging 1.00
R4624:Pick1 UTSW 15 79246466 missense probably damaging 1.00
R4646:Pick1 UTSW 15 79248937 missense probably benign 0.26
R4796:Pick1 UTSW 15 79255610 unclassified probably benign
R5869:Pick1 UTSW 15 79248895 missense probably benign 0.02
R6047:Pick1 UTSW 15 79255695 unclassified probably benign
R6128:Pick1 UTSW 15 79239696 missense probably damaging 0.98
R6291:Pick1 UTSW 15 79251728 splice site probably null
R7042:Pick1 UTSW 15 79248765 missense probably damaging 0.98
R7564:Pick1 UTSW 15 79255581 missense unknown
R8211:Pick1 UTSW 15 79248730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCCGTCATAGTCACTG -3'
(R):5'- ATGCGCCACTATATGCCTTC -3'

Sequencing Primer
(F):5'- CATAGTCACTGGGCCTGTCTG -3'
(R):5'- TGTCCTACAGTGGTCCCG -3'
Posted On2016-09-01