Incidental Mutation 'R5420:Adamts1'
ID428020
Institutional Source Beutler Lab
Gene Symbol Adamts1
Ensembl Gene ENSMUSG00000022893
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
SynonymsMETH1, ADAMTS-1, ADAM-TS1, METH-1
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location85793827-85803113 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85799609 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 117 (C117*)
Ref Sequence ENSEMBL: ENSMUSP00000118471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]
Predicted Effect probably null
Transcript: ENSMUST00000023610
AA Change: C380*
SMART Domains Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: C380*

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 22 194 1.3e-27 PFAM
Pfam:Reprolysin_4 257 464 2.2e-9 PFAM
Pfam:Reprolysin_5 257 466 1.6e-14 PFAM
Pfam:Reprolysin 259 468 3.6e-22 PFAM
Pfam:Reprolysin_2 279 458 2.1e-10 PFAM
Pfam:Reprolysin_3 281 413 4.8e-14 PFAM
ACR 469 549 7.36e-8 SMART
TSP1 563 615 3.77e-14 SMART
Pfam:ADAM_spacer1 726 844 1.7e-35 PFAM
TSP1 858 911 1.22e-8 SMART
TSP1 912 968 1.2e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125897
AA Change: C117*
SMART Domains Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: C117*

DomainStartEndE-ValueType
Pfam:Reprolysin_4 1 201 2.3e-9 PFAM
Pfam:Reprolysin_5 1 203 8.8e-14 PFAM
Pfam:Reprolysin 1 205 5e-22 PFAM
Pfam:Reprolysin_2 16 195 8.6e-10 PFAM
Pfam:Reprolysin_3 19 150 4.2e-14 PFAM
ACR 206 286 7.36e-8 SMART
TSP1 300 352 3.77e-14 SMART
Pfam:ADAM_spacer1 463 581 3e-35 PFAM
TSP1 595 648 1.22e-8 SMART
TSP1 649 680 4.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138474
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rdh16f2 C T 10: 127,877,074 P314S possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Adamts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Adamts1 APN 16 85795573 missense probably benign
IGL01753:Adamts1 APN 16 85802224 missense probably benign 0.00
IGL02238:Adamts1 APN 16 85795825 missense probably benign 0.01
IGL02655:Adamts1 APN 16 85802617 missense probably benign
gambler UTSW 16 85799609 nonsense probably null
sure_thing UTSW 16 85798544 missense probably damaging 1.00
PIT4466001:Adamts1 UTSW 16 85796691 nonsense probably null
R0114:Adamts1 UTSW 16 85799614 missense probably benign 0.10
R0135:Adamts1 UTSW 16 85798703 splice site probably benign
R0179:Adamts1 UTSW 16 85795465 missense probably benign 0.00
R0517:Adamts1 UTSW 16 85800353 missense possibly damaging 0.96
R0526:Adamts1 UTSW 16 85802372 missense probably benign
R0727:Adamts1 UTSW 16 85798648 missense possibly damaging 0.51
R0899:Adamts1 UTSW 16 85798052 nonsense probably null
R1163:Adamts1 UTSW 16 85802637 missense probably benign 0.07
R1555:Adamts1 UTSW 16 85797888 missense probably benign 0.17
R1598:Adamts1 UTSW 16 85798511 nonsense probably null
R1643:Adamts1 UTSW 16 85796817 splice site probably benign
R1847:Adamts1 UTSW 16 85802226 missense possibly damaging 0.89
R2045:Adamts1 UTSW 16 85795976 missense probably damaging 1.00
R2093:Adamts1 UTSW 16 85802445 missense probably benign 0.23
R2966:Adamts1 UTSW 16 85796774 missense possibly damaging 0.94
R3937:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R3938:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R4348:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4350:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4351:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4352:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4470:Adamts1 UTSW 16 85798516 missense possibly damaging 0.88
R4724:Adamts1 UTSW 16 85802505 missense probably benign 0.00
R4775:Adamts1 UTSW 16 85800390 nonsense probably null
R4972:Adamts1 UTSW 16 85795945 missense probably damaging 1.00
R5353:Adamts1 UTSW 16 85802608 missense probably benign 0.00
R5551:Adamts1 UTSW 16 85797746 missense probably benign
R5574:Adamts1 UTSW 16 85799642 missense probably damaging 1.00
R5759:Adamts1 UTSW 16 85798048 missense possibly damaging 0.93
R5860:Adamts1 UTSW 16 85798544 missense probably damaging 1.00
R5910:Adamts1 UTSW 16 85802149 missense probably benign 0.00
R6240:Adamts1 UTSW 16 85802157 missense probably benign
R6473:Adamts1 UTSW 16 85799643 missense probably damaging 1.00
R6623:Adamts1 UTSW 16 85795637 missense probably benign 0.20
R6628:Adamts1 UTSW 16 85795825 missense probably benign 0.05
R7034:Adamts1 UTSW 16 85802746 unclassified probably benign
R7174:Adamts1 UTSW 16 85799172 missense probably benign 0.00
R7572:Adamts1 UTSW 16 85797741 missense possibly damaging 0.51
R7759:Adamts1 UTSW 16 85797795 missense probably damaging 1.00
R7808:Adamts1 UTSW 16 85800229 missense probably damaging 0.99
R7880:Adamts1 UTSW 16 85798052 nonsense probably null
R7985:Adamts1 UTSW 16 85798114 missense probably damaging 1.00
R7986:Adamts1 UTSW 16 85799547 missense probably damaging 1.00
R8118:Adamts1 UTSW 16 85795933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTTCTAAAATTGCTGGTG -3'
(R):5'- TTTAGAGTCAGTCCTTCAAGTCC -3'

Sequencing Primer
(F):5'- CCTTCTAAAATTGCTGGTGGCTGAG -3'
(R):5'- GTCCTTCAAGTCCAGCAATAATG -3'
Posted On2016-09-01