Incidental Mutation 'R5431:Kel'
ID428045
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 042847-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41698420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 299 (S299F)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
AA Change: S299F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: S299F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCACAGGTGCCTTCCAC -3'
(R):5'- CTGTGGGACTTTAGGCAGAAATG -3'

Sequencing Primer
(F):5'- ACTCACGGTGCCCCTGATAC -3'
(R):5'- GCCTTCTACCATATAGGCTAGGAG -3'
Posted On2016-09-01