Incidental Mutation 'R5431:Tcaf3'
ID 428046
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042847-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5431 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42597185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 31 (L31P)
Ref Sequence ENSEMBL: ENSMUSP00000123321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: L31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: L31P

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134707
AA Change: L31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: L31P

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTAAGGAAGAATGCACCGC -3'
(R):5'- TCGTCGTGTAAGACTCTGTG -3'

Sequencing Primer
(F):5'- AATGCACCGCTATGGGAG -3'
(R):5'- CGTCGTGTAAGACTCTGTGAAAACAC -3'
Posted On 2016-09-01