Incidental Mutation 'R5431:Grm7'

• ID: 428047
• Institutional Source: Beutler Lab
• Gene Symbol: Grm7
• Ensembl Gene: ENSMUSG00000056755
• Gene Name: glutamate receptor, metabotropic 7
• Synonyms: Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
• MMRRC Submission: 042847-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R5431 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 6
• Chromosomal Location: 110645581-111567230 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): G to A at 111358426 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Methionine to Isoleucine at position 599 (M599I)
• Ref Sequence: ENSEMBL: ENSMUSP00000133957
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
• AlphaFold: Q68ED2
• Predicted Effect: probably benign; Transcript: ENSMUST00000071076; AA Change: M599I; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000064404; Gene: ENSMUSG00000056755; AA Change: M599I

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000172951; AA Change: M599I; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000133957; Gene: ENSMUSG00000056755; AA Change: M599I

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000174018
• SMART Domains: Protein: ENSMUSP00000134635; Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009] ; PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
• Posted On: 2016-09-01

Predicted Primers

PCR Primer
(F):5'- TCTGTGTGCACATTGCCATG -3'
(R):5'- GAACACACTGCCACATCTGG -3'

Sequencing Primer
(F):5'- TTGCCATGCAAGCCTGG -3'
(R):5'- CACATCTGGCTTGGCAATCATTAGG -3'