Incidental Mutation 'R5431:Ryr1'
ID 428050
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms calcium release channel isoform 1, Ryr, skrr
MMRRC Submission 042847-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5431 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 28702765-28824599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28809237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 386 (D386V)
Ref Sequence ENSEMBL: ENSMUSP00000137123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032813
AA Change: D386V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: D386V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: D386V

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: D386V

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207783
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: D393V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,504,426 (GRCm39) S124G possibly damaging Het
4921539E11Rik T C 4: 103,128,045 (GRCm39) T27A probably benign Het
Aspg T A 12: 112,089,846 (GRCm39) N461K probably benign Het
B4galnt3 T A 6: 120,195,928 (GRCm39) T300S probably damaging Het
BC035044 A G 6: 128,861,970 (GRCm39) probably benign Het
Bmp5 C T 9: 75,800,991 (GRCm39) P374S probably damaging Het
C330018D20Rik A T 18: 57,090,928 (GRCm39) F78L probably benign Het
Cds2 T A 2: 132,144,090 (GRCm39) S289T probably benign Het
Cerkl C T 2: 79,171,679 (GRCm39) C393Y probably damaging Het
Cibar2 C A 8: 120,894,042 (GRCm39) probably null Het
Ciita C T 16: 10,341,656 (GRCm39) R1020C probably damaging Het
Dcaf13 C A 15: 38,986,619 (GRCm39) D130E probably benign Het
Dnal4 C T 15: 79,646,648 (GRCm39) G50R probably damaging Het
Elfn1 A G 5: 139,957,323 (GRCm39) N109S probably damaging Het
Ep400 A G 5: 110,824,420 (GRCm39) V2435A unknown Het
Fam178b T C 1: 36,671,566 (GRCm39) E185G probably damaging Het
Fam227b C A 2: 125,968,851 (GRCm39) L74F probably benign Het
Fgfr4 G A 13: 55,304,464 (GRCm39) V138I probably benign Het
Flnc A G 6: 29,456,383 (GRCm39) I2161V possibly damaging Het
Frmd5 T C 2: 121,393,390 (GRCm39) N235S probably damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Ggt6 A G 11: 72,328,564 (GRCm39) T355A possibly damaging Het
Gm14393 G A 2: 174,905,669 (GRCm39) T41I probably damaging Het
Gpr151 A C 18: 42,711,932 (GRCm39) S249A probably damaging Het
Gpr152 T A 19: 4,193,746 (GRCm39) V429D probably benign Het
Grm7 G A 6: 111,335,387 (GRCm39) M599I probably benign Het
Hdac4 T A 1: 91,900,512 (GRCm39) R54* probably null Het
Ice1 A G 13: 70,740,769 (GRCm39) L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 (GRCm39) V183I probably benign Het
Kel G A 6: 41,675,354 (GRCm39) S299F probably benign Het
Kif14 T C 1: 136,424,433 (GRCm39) I1016T possibly damaging Het
Lhx3 T C 2: 26,091,130 (GRCm39) D395G probably damaging Het
Micu1 T C 10: 59,586,343 (GRCm39) Y140H possibly damaging Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Nbn C T 4: 15,986,593 (GRCm39) H665Y probably benign Het
Pkhd1 G T 1: 20,188,060 (GRCm39) T3416K probably benign Het
Plxnb1 T C 9: 108,929,840 (GRCm39) F232S probably damaging Het
Pus7l T C 15: 94,427,367 (GRCm39) N472D probably damaging Het
Rfx1 C T 8: 84,809,349 (GRCm39) Q225* probably null Het
Rnase2a T C 14: 51,493,020 (GRCm39) Y115C possibly damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Homo
Sgcz T A 8: 38,107,138 (GRCm39) T125S probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Syt2 A G 1: 134,668,695 (GRCm39) S36G probably benign Het
Tcaf3 A G 6: 42,574,119 (GRCm39) L31P probably damaging Het
Tenm3 C A 8: 48,820,412 (GRCm39) E142* probably null Het
Tgfbr2 G T 9: 115,960,669 (GRCm39) S94R probably damaging Het
Tut4 T A 4: 108,348,609 (GRCm39) I297N probably damaging Het
Vmn2r12 A G 5: 109,239,684 (GRCm39) I293T probably damaging Het
Wrap73 G A 4: 154,229,731 (GRCm39) R34Q probably damaging Het
Zc3h14 A G 12: 98,746,324 (GRCm39) D511G possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 28,802,235 (GRCm39) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 28,824,385 (GRCm39) splice site probably null
IGL00427:Ryr1 APN 7 28,804,162 (GRCm39) splice site probably benign
IGL00559:Ryr1 APN 7 28,711,667 (GRCm39) splice site probably benign
IGL00803:Ryr1 APN 7 28,769,070 (GRCm39) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 28,723,654 (GRCm39) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 28,719,620 (GRCm39) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 28,781,968 (GRCm39) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 28,799,627 (GRCm39) splice site probably benign
IGL01385:Ryr1 APN 7 28,756,410 (GRCm39) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 28,751,762 (GRCm39) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 28,774,652 (GRCm39) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 28,790,501 (GRCm39) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 28,778,022 (GRCm39) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 28,759,235 (GRCm39) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 28,771,083 (GRCm39) missense probably benign 0.16
IGL02152:Ryr1 APN 7 28,751,440 (GRCm39) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 28,793,472 (GRCm39) missense probably benign 0.07
IGL02321:Ryr1 APN 7 28,778,121 (GRCm39) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 28,804,491 (GRCm39) splice site probably benign
IGL02472:Ryr1 APN 7 28,740,269 (GRCm39) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 28,815,024 (GRCm39) missense probably benign 0.24
IGL02666:Ryr1 APN 7 28,719,188 (GRCm39) missense unknown
IGL02672:Ryr1 APN 7 28,703,944 (GRCm39) unclassified probably benign
IGL02677:Ryr1 APN 7 28,810,033 (GRCm39) missense probably benign 0.18
IGL02686:Ryr1 APN 7 28,768,975 (GRCm39) splice site probably benign
IGL02751:Ryr1 APN 7 28,778,199 (GRCm39) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 28,748,220 (GRCm39) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 28,760,965 (GRCm39) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 28,796,884 (GRCm39) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 28,759,478 (GRCm39) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 28,743,318 (GRCm39) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 28,770,084 (GRCm39) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 28,782,911 (GRCm39) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 28,804,018 (GRCm39) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 28,774,624 (GRCm39) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 28,802,389 (GRCm39) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 28,715,211 (GRCm39) missense unknown
IGL03146:Ryr1 APN 7 28,793,457 (GRCm39) missense probably benign 0.09
IGL03165:Ryr1 APN 7 28,804,465 (GRCm39) missense probably benign 0.22
IGL03220:Ryr1 APN 7 28,759,280 (GRCm39) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 28,746,967 (GRCm39) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0069:Ryr1 UTSW 7 28,809,930 (GRCm39) splice site probably benign
R0148:Ryr1 UTSW 7 28,751,460 (GRCm39) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 28,767,013 (GRCm39) splice site probably benign
R0387:Ryr1 UTSW 7 28,782,792 (GRCm39) splice site probably benign
R0454:Ryr1 UTSW 7 28,735,500 (GRCm39) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 28,703,218 (GRCm39) splice site probably benign
R0533:Ryr1 UTSW 7 28,778,205 (GRCm39) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 28,735,501 (GRCm39) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 28,804,220 (GRCm39) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 28,774,034 (GRCm39) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 28,799,614 (GRCm39) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 28,709,122 (GRCm39) missense unknown
R1052:Ryr1 UTSW 7 28,795,683 (GRCm39) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 28,785,534 (GRCm39) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 28,815,437 (GRCm39) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 28,770,046 (GRCm39) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 28,782,962 (GRCm39) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 28,791,600 (GRCm39) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 28,761,616 (GRCm39) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 28,794,915 (GRCm39) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 28,793,686 (GRCm39) missense probably benign 0.03
R1661:Ryr1 UTSW 7 28,801,163 (GRCm39) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 28,735,503 (GRCm39) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 28,815,579 (GRCm39) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 28,777,989 (GRCm39) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 28,746,928 (GRCm39) missense probably benign 0.25
R1720:Ryr1 UTSW 7 28,801,295 (GRCm39) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 28,767,046 (GRCm39) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 28,779,236 (GRCm39) missense probably benign 0.43
R1860:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1861:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1921:Ryr1 UTSW 7 28,754,369 (GRCm39) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 28,758,897 (GRCm39) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 28,759,056 (GRCm39) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 28,789,575 (GRCm39) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 28,767,867 (GRCm39) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 28,719,166 (GRCm39) missense unknown
R2291:Ryr1 UTSW 7 28,798,202 (GRCm39) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 28,774,718 (GRCm39) missense probably benign 0.18
R2512:Ryr1 UTSW 7 28,802,967 (GRCm39) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 28,735,551 (GRCm39) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 28,708,987 (GRCm39) missense unknown
R2885:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 28,778,166 (GRCm39) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 28,745,071 (GRCm39) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 28,774,373 (GRCm39) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 28,769,075 (GRCm39) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 28,719,577 (GRCm39) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 28,772,327 (GRCm39) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 28,794,549 (GRCm39) missense probably benign 0.41
R4041:Ryr1 UTSW 7 28,785,356 (GRCm39) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 28,761,576 (GRCm39) nonsense probably null
R4257:Ryr1 UTSW 7 28,781,875 (GRCm39) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 28,782,484 (GRCm39) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 28,793,667 (GRCm39) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 28,789,581 (GRCm39) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 28,798,160 (GRCm39) missense probably benign 0.05
R4554:Ryr1 UTSW 7 28,804,433 (GRCm39) missense probably benign 0.03
R4562:Ryr1 UTSW 7 28,774,005 (GRCm39) intron probably benign
R4642:Ryr1 UTSW 7 28,785,463 (GRCm39) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 28,759,256 (GRCm39) missense probably null 0.99
R4707:Ryr1 UTSW 7 28,745,087 (GRCm39) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 28,785,258 (GRCm39) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 28,704,246 (GRCm39) unclassified probably benign
R4770:Ryr1 UTSW 7 28,808,707 (GRCm39) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 28,794,522 (GRCm39) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 28,719,408 (GRCm39) missense unknown
R4933:Ryr1 UTSW 7 28,803,723 (GRCm39) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 28,767,520 (GRCm39) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 28,768,998 (GRCm39) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 28,778,208 (GRCm39) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 28,768,540 (GRCm39) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5013:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5137:Ryr1 UTSW 7 28,801,283 (GRCm39) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 28,767,118 (GRCm39) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 28,735,553 (GRCm39) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 28,815,023 (GRCm39) missense probably benign 0.03
R5303:Ryr1 UTSW 7 28,767,907 (GRCm39) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 28,816,841 (GRCm39) missense probably damaging 0.98
R5460:Ryr1 UTSW 7 28,771,386 (GRCm39) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 28,723,448 (GRCm39) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 28,768,453 (GRCm39) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 28,785,610 (GRCm39) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 28,715,148 (GRCm39) missense unknown
R5575:Ryr1 UTSW 7 28,778,118 (GRCm39) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 28,811,399 (GRCm39) missense probably benign 0.05
R5658:Ryr1 UTSW 7 28,790,514 (GRCm39) splice site probably null
R5918:Ryr1 UTSW 7 28,708,577 (GRCm39) missense probably benign 0.39
R5926:Ryr1 UTSW 7 28,803,785 (GRCm39) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 28,746,290 (GRCm39) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 28,815,552 (GRCm39) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 28,771,349 (GRCm39) missense probably null 0.98
R5991:Ryr1 UTSW 7 28,804,035 (GRCm39) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 28,767,062 (GRCm39) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 28,723,666 (GRCm39) missense probably benign 0.38
R6075:Ryr1 UTSW 7 28,786,863 (GRCm39) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 28,771,398 (GRCm39) missense probably benign 0.01
R6126:Ryr1 UTSW 7 28,775,664 (GRCm39) missense probably null 1.00
R6147:Ryr1 UTSW 7 28,785,339 (GRCm39) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 28,815,606 (GRCm39) missense probably benign 0.07
R6279:Ryr1 UTSW 7 28,786,853 (GRCm39) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 28,774,682 (GRCm39) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 28,759,120 (GRCm39) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 28,776,503 (GRCm39) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 28,715,079 (GRCm39) missense probably benign 0.39
R6514:Ryr1 UTSW 7 28,746,266 (GRCm39) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 28,794,917 (GRCm39) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 28,737,770 (GRCm39) critical splice donor site probably null
R6746:Ryr1 UTSW 7 28,816,829 (GRCm39) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 28,764,299 (GRCm39) missense probably benign 0.12
R6800:Ryr1 UTSW 7 28,723,741 (GRCm39) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 28,751,751 (GRCm39) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 28,808,812 (GRCm39) missense probably benign 0.03
R6995:Ryr1 UTSW 7 28,793,607 (GRCm39) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 28,803,068 (GRCm39) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 28,746,279 (GRCm39) missense probably benign 0.37
R7238:Ryr1 UTSW 7 28,794,807 (GRCm39) missense probably benign 0.24
R7240:Ryr1 UTSW 7 28,751,440 (GRCm39) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 28,758,936 (GRCm39) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 28,785,180 (GRCm39) missense probably benign 0.05
R7403:Ryr1 UTSW 7 28,713,292 (GRCm39) missense probably benign 0.34
R7422:Ryr1 UTSW 7 28,785,295 (GRCm39) missense probably benign 0.00
R7493:Ryr1 UTSW 7 28,794,630 (GRCm39) missense probably benign 0.44
R7570:Ryr1 UTSW 7 28,778,010 (GRCm39) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 28,735,528 (GRCm39) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 28,798,210 (GRCm39) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 28,767,055 (GRCm39) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 28,804,257 (GRCm39) missense probably benign 0.39
R7799:Ryr1 UTSW 7 28,702,985 (GRCm39) splice site probably null
R7916:Ryr1 UTSW 7 28,790,364 (GRCm39) nonsense probably null
R7922:Ryr1 UTSW 7 28,796,649 (GRCm39) missense probably benign 0.09
R7988:Ryr1 UTSW 7 28,795,596 (GRCm39) missense probably benign 0.29
R7997:Ryr1 UTSW 7 28,702,968 (GRCm39) missense unknown
R8052:Ryr1 UTSW 7 28,782,810 (GRCm39) missense probably benign 0.05
R8096:Ryr1 UTSW 7 28,708,626 (GRCm39) missense unknown
R8116:Ryr1 UTSW 7 28,810,308 (GRCm39) missense probably benign 0.03
R8202:Ryr1 UTSW 7 28,790,457 (GRCm39) missense probably benign 0.18
R8207:Ryr1 UTSW 7 28,789,650 (GRCm39) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 28,768,546 (GRCm39) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 28,764,064 (GRCm39) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8454:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8487:Ryr1 UTSW 7 28,740,292 (GRCm39) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 28,769,509 (GRCm39) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 28,704,239 (GRCm39) unclassified probably benign
R8678:Ryr1 UTSW 7 28,776,489 (GRCm39) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 28,751,753 (GRCm39) missense probably benign 0.03
R8724:Ryr1 UTSW 7 28,816,802 (GRCm39) missense probably benign 0.04
R8755:Ryr1 UTSW 7 28,791,693 (GRCm39) missense probably benign 0.19
R8772:Ryr1 UTSW 7 28,815,557 (GRCm39) missense probably benign 0.05
R8790:Ryr1 UTSW 7 28,776,297 (GRCm39) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 28,764,284 (GRCm39) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 28,774,091 (GRCm39) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 28,808,638 (GRCm39) missense probably benign 0.00
R8910:Ryr1 UTSW 7 28,771,340 (GRCm39) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 28,789,640 (GRCm39) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 28,801,358 (GRCm39) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 28,790,422 (GRCm39) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 28,803,989 (GRCm39) nonsense probably null
R9123:Ryr1 UTSW 7 28,771,229 (GRCm39) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 28,769,283 (GRCm39) missense probably benign 0.08
R9189:Ryr1 UTSW 7 28,776,471 (GRCm39) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 28,794,524 (GRCm39) missense probably benign 0.00
R9214:Ryr1 UTSW 7 28,785,187 (GRCm39) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 28,801,277 (GRCm39) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 28,743,313 (GRCm39) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 28,751,813 (GRCm39) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 28,802,254 (GRCm39) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 28,802,389 (GRCm39) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 28,717,387 (GRCm39) missense unknown
R9333:Ryr1 UTSW 7 28,774,214 (GRCm39) critical splice donor site probably null
R9459:Ryr1 UTSW 7 28,768,068 (GRCm39) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 28,772,510 (GRCm39) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 28,777,965 (GRCm39) missense probably benign 0.15
R9524:Ryr1 UTSW 7 28,723,600 (GRCm39) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 28,715,138 (GRCm39) missense unknown
R9664:Ryr1 UTSW 7 28,759,092 (GRCm39) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 28,774,664 (GRCm39) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 28,760,956 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,802,923 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,785,460 (GRCm39) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 28,719,639 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,801,347 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,748,217 (GRCm39) nonsense probably null
Z1177:Ryr1 UTSW 7 28,717,410 (GRCm39) missense unknown
Z1186:Ryr1 UTSW 7 28,781,902 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAGTCAAAGGCTGTGGGTGC -3'
(R):5'- AATCTTCCAAACAATAGCAGGCTG -3'

Sequencing Primer
(F):5'- CTGTGGGTGCCAGAAGTCTC -3'
(R):5'- ACTGTGAGTTCGAAGTCAGCC -3'
Posted On 2016-09-01