Mutagenetix > Incidental Mutation

Incidental Mutation 'R5431:Plxnb1'

428056

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

MMRRC Submission

042847-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5431 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109100772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 232 (F232S)

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]

AlphaFold

Q8CJH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000072093
AA Change: F232S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: F232S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130366

SMART Domains

Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sema	35	138	7.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131462

SMART Domains

Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sema	35	138	7.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134690

Predicted Effect

probably benign
Transcript: ENSMUST00000192988

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195364

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	C	16: 88,707,538	S124G	possibly damaging	Het
4921539E11Rik	T	C	4: 103,270,848	T27A	probably benign	Het
Aspg	T	A	12: 112,123,412	N461K	probably benign	Het
B4galnt3	T	A	6: 120,218,967	T300S	probably damaging	Het
BC035044	A	G	6: 128,885,007		probably benign	Het
Bmp5	C	T	9: 75,893,709	P374S	probably damaging	Het
C330018D20Rik	A	T	18: 56,957,856	F78L	probably benign	Het
Cds2	T	A	2: 132,302,170	S289T	probably benign	Het
Cerkl	C	T	2: 79,341,335	C393Y	probably damaging	Het
Ciita	C	T	16: 10,523,792	R1020C	probably damaging	Het
Dcaf13	C	A	15: 39,123,224	D130E	probably benign	Het
Dnal4	C	T	15: 79,762,447	G50R	probably damaging	Het
Elfn1	A	G	5: 139,971,568	N109S	probably damaging	Het
Ep400	A	G	5: 110,676,554	V2435A	unknown	Het
Fam178b	T	C	1: 36,632,485	E185G	probably damaging	Het
Fam227b	C	A	2: 126,126,931	L74F	probably benign	Het
Fam92b	C	A	8: 120,167,303		probably null	Het
Fgfr4	G	A	13: 55,156,651	V138I	probably benign	Het
Flnc	A	G	6: 29,456,384	I2161V	possibly damaging	Het
Frmd5	T	C	2: 121,562,909	N235S	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ggt6	A	G	11: 72,437,738	T355A	possibly damaging	Het
Gm14393	G	A	2: 175,063,876	T41I	probably damaging	Het
Gpr151	A	C	18: 42,578,867	S249A	probably damaging	Het
Gpr152	T	A	19: 4,143,747	V429D	probably benign	Het
Grm7	G	A	6: 111,358,426	M599I	probably benign	Het
Hdac4	T	A	1: 91,972,790	R54*	probably null	Het
Ice1	A	G	13: 70,592,650	L2146S	probably damaging	Het
Igfbpl1	C	T	4: 45,815,588	V183I	probably benign	Het
Kel	G	A	6: 41,698,420	S299F	probably benign	Het
Kif14	T	C	1: 136,496,695	I1016T	possibly damaging	Het
Lhx3	T	C	2: 26,201,118	D395G	probably damaging	Het
Micu1	T	C	10: 59,750,521	Y140H	possibly damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nbn	C	T	4: 15,986,593	H665Y	probably benign	Het
Pkhd1	G	T	1: 20,117,836	T3416K	probably benign	Het
Pus7l	T	C	15: 94,529,486	N472D	probably damaging	Het
Rfx1	C	T	8: 84,082,720	Q225*	probably null	Het
Rnase2a	T	C	14: 51,255,563	Y115C	possibly damaging	Het
Ryr1	T	A	7: 29,109,812	D386V	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sgcz	T	A	8: 37,639,984	T125S	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Syt2	A	G	1: 134,740,957	S36G	probably benign	Het
Tcaf3	A	G	6: 42,597,185	L31P	probably damaging	Het
Tenm3	C	A	8: 48,367,377	E142*	probably null	Het
Tgfbr2	G	T	9: 116,131,601	S94R	probably damaging	Het
Vmn2r12	A	G	5: 109,091,818	I293T	probably damaging	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Zc3h14	A	G	12: 98,780,065	D511G	possibly damaging	Het
Zcchc11	T	A	4: 108,491,412	I297N	probably damaging	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R1936:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2422:Plxnb1	UTSW	9	109108438	missense	probably benign	0.02
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4796:Plxnb1	UTSW	9	109114595	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6020:Plxnb1	UTSW	9	109116611	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6734:Plxnb1	UTSW	9	109108920	nonsense	probably null
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
R8987:Plxnb1	UTSW	9	109108110	splice site	probably benign
R9176:Plxnb1	UTSW	9	109112583	missense	probably damaging	1.00
R9231:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.59
R9698:Plxnb1	UTSW	9	109096183	start gained	probably benign
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TGACCCTGCAGTCAGTACAG -3'
(R):5'- AAGCTGCAAAGAGTACGTCC -3'

Sequencing Primer
(F):5'- CTGCAGTCAGTACAGTGGGG -3'
(R):5'- CAGGGGCAATTCCACATA -3'

Posted On

2016-09-01