Mutagenetix > Incidental Mutations

Incidental Mutation 'R5431:Tgfbr2'

428057

Institutional Source

Beutler Lab

Gene Symbol

Tgfbr2

Ensembl Gene

ENSMUSG00000032440

Gene Name

transforming growth factor, beta receptor II

Synonyms

TbetaR-II, TBR-II, TbetaRII, 1110020H15Rik

MMRRC Submission

042847-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5431 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116084293-116175360 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 116131601 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 94 (S94R)

Ref Sequence

ENSEMBL: ENSMUSP00000062333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035014
AA Change: S69R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: S69R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	47	165	1.8e-55	PFAM
Pfam:Pkinase	244	538	9.9e-52	PFAM
Pfam:Pkinase_Tyr	244	538	2.9e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000061101
AA Change: S94R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: S94R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	74	184	4.6e-45	PFAM
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:Pkinase	269	563	2.7e-36	PFAM
Pfam:Pkinase_Tyr	269	563	5e-37	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	C	16: 88,707,538	S124G	possibly damaging	Het
4921539E11Rik	T	C	4: 103,270,848	T27A	probably benign	Het
Aspg	T	A	12: 112,123,412	N461K	probably benign	Het
B4galnt3	T	A	6: 120,218,967	T300S	probably damaging	Het
BC035044	A	G	6: 128,885,007		probably benign	Het
Bmp5	C	T	9: 75,893,709	P374S	probably damaging	Het
C330018D20Rik	A	T	18: 56,957,856	F78L	probably benign	Het
Cds2	T	A	2: 132,302,170	S289T	probably benign	Het
Cerkl	C	T	2: 79,341,335	C393Y	probably damaging	Het
Ciita	C	T	16: 10,523,792	R1020C	probably damaging	Het
Dcaf13	C	A	15: 39,123,224	D130E	probably benign	Het
Dnal4	C	T	15: 79,762,447	G50R	probably damaging	Het
Elfn1	A	G	5: 139,971,568	N109S	probably damaging	Het
Ep400	A	G	5: 110,676,554	V2435A	unknown	Het
Fam178b	T	C	1: 36,632,485	E185G	probably damaging	Het
Fam227b	C	A	2: 126,126,931	L74F	probably benign	Het
Fam92b	C	A	8: 120,167,303		probably null	Het
Fgfr4	G	A	13: 55,156,651	V138I	probably benign	Het
Flnc	A	G	6: 29,456,384	I2161V	possibly damaging	Het
Frmd5	T	C	2: 121,562,909	N235S	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ggt6	A	G	11: 72,437,738	T355A	possibly damaging	Het
Gm14393	G	A	2: 175,063,876	T41I	probably damaging	Het
Gpr151	A	C	18: 42,578,867	S249A	probably damaging	Het
Gpr152	T	A	19: 4,143,747	V429D	probably benign	Het
Grm7	G	A	6: 111,358,426	M599I	probably benign	Het
Hdac4	T	A	1: 91,972,790	R54*	probably null	Het
Ice1	A	G	13: 70,592,650	L2146S	probably damaging	Het
Igfbpl1	C	T	4: 45,815,588	V183I	probably benign	Het
Kel	G	A	6: 41,698,420	S299F	probably benign	Het
Kif14	T	C	1: 136,496,695	I1016T	possibly damaging	Het
Lhx3	T	C	2: 26,201,118	D395G	probably damaging	Het
Micu1	T	C	10: 59,750,521	Y140H	possibly damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nbn	C	T	4: 15,986,593	H665Y	probably benign	Het
Pkhd1	G	T	1: 20,117,836	T3416K	probably benign	Het
Plxnb1	T	C	9: 109,100,772	F232S	probably damaging	Het
Pus7l	T	C	15: 94,529,486	N472D	probably damaging	Het
Rfx1	C	T	8: 84,082,720	Q225*	probably null	Het
Rnase2a	T	C	14: 51,255,563	Y115C	possibly damaging	Het
Ryr1	T	A	7: 29,109,812	D386V	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sgcz	T	A	8: 37,639,984	T125S	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Syt2	A	G	1: 134,740,957	S36G	probably benign	Het
Tcaf3	A	G	6: 42,597,185	L31P	probably damaging	Het
Tenm3	C	A	8: 48,367,377	E142*	probably null	Het
Vmn2r12	A	G	5: 109,091,818	I293T	probably damaging	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Zc3h14	A	G	12: 98,780,065	D511G	possibly damaging	Het
Zcchc11	T	A	4: 108,491,412	I297N	probably damaging	Het

Other mutations in Tgfbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tgfbr2	APN	9	116110189	missense	probably damaging	0.99
IGL00484:Tgfbr2	APN	9	116158289	missense	probably benign	0.00
IGL01010:Tgfbr2	APN	9	116129980	missense	possibly damaging	0.80
IGL01656:Tgfbr2	APN	9	116109669	missense	probably damaging	1.00
IGL02496:Tgfbr2	APN	9	116090418	missense	probably benign	0.13
IGL02550:Tgfbr2	APN	9	116110129	missense	probably benign
IGL02563:Tgfbr2	APN	9	116129998	missense	probably benign	0.10
IGL03403:Tgfbr2	APN	9	116110302	missense	probably benign
IGL02799:Tgfbr2	UTSW	9	116110136	missense	possibly damaging	0.50
R0617:Tgfbr2	UTSW	9	116158320	missense	probably benign	0.00
R1483:Tgfbr2	UTSW	9	116109557	missense	probably benign	0.04
R1776:Tgfbr2	UTSW	9	116174967	missense	possibly damaging	0.94
R1777:Tgfbr2	UTSW	9	116109880	missense	probably damaging	0.99
R1831:Tgfbr2	UTSW	9	116090536	missense	possibly damaging	0.74
R2323:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R2378:Tgfbr2	UTSW	9	116129950	missense	probably benign	0.02
R3123:Tgfbr2	UTSW	9	116110069	missense	possibly damaging	0.95
R3418:Tgfbr2	UTSW	9	116129833	missense	probably damaging	1.00
R3605:Tgfbr2	UTSW	9	116109892	missense	probably benign	0.03
R4039:Tgfbr2	UTSW	9	116175037	start codon destroyed	probably null	0.62
R4191:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4193:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4945:Tgfbr2	UTSW	9	116131565	missense	probably benign
R5714:Tgfbr2	UTSW	9	116175024	missense	probably damaging	0.98
R5964:Tgfbr2	UTSW	9	116110255	missense	possibly damaging	0.64
R6180:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R6970:Tgfbr2	UTSW	9	116110051	missense	probably damaging	0.97
R7228:Tgfbr2	UTSW	9	116109943	missense	probably damaging	1.00
R7258:Tgfbr2	UTSW	9	116129830	missense	probably damaging	0.98
R7315:Tgfbr2	UTSW	9	116109738	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TATGTGATACACGGGACTGTG -3'
(R):5'- TTTCTAGCACGGGATCCCATG -3'

Sequencing Primer
(F):5'- TAGACTGTGTCCCCCTAGAACTGG -3'
(R):5'- ATCCCATGGAGTAACCTCTGG -3'

Posted On

2016-09-01