Incidental Mutation 'R5431:Gad1-ps'
ID 428059
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 042847-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R5431 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99443838-99447029 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) G to A at 99445147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.2911 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99445448 exon noncoding transcript
IGL01301:Gad1-ps APN 10 99445151 exon noncoding transcript
IGL01394:Gad1-ps APN 10 99445562 exon noncoding transcript
IGL02220:Gad1-ps APN 10 99445322 exon noncoding transcript
IGL02240:Gad1-ps APN 10 99444958 exon noncoding transcript
IGL03406:Gad1-ps APN 10 99444779 exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99445151 exon noncoding transcript
R0305:Gad1-ps UTSW 10 99444803 exon noncoding transcript
R0446:Gad1-ps UTSW 10 99445521 exon noncoding transcript
R0538:Gad1-ps UTSW 10 99444992 exon noncoding transcript
R1511:Gad1-ps UTSW 10 99445469 exon noncoding transcript
R1734:Gad1-ps UTSW 10 99445775 exon noncoding transcript
R1745:Gad1-ps UTSW 10 99445524 exon noncoding transcript
R1886:Gad1-ps UTSW 10 99445582 exon noncoding transcript
R3111:Gad1-ps UTSW 10 99444521 exon noncoding transcript
R3617:Gad1-ps UTSW 10 99445398 exon noncoding transcript
R5042:Gad1-ps UTSW 10 99445654 exon noncoding transcript
R5223:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5234:Gad1-ps UTSW 10 99445326 exon noncoding transcript
R5275:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5295:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5334:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5335:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5336:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5337:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5396:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5397:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5399:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5428:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5429:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5661:Gad1-ps UTSW 10 99445039 exon noncoding transcript
R5667:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5671:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5885:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5886:Gad1-ps UTSW 10 99445147 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGGCTTTGGAACAGACAATG -3'
(R):5'- AAGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'
Posted On 2016-09-01