Mutagenetix > Incidental Mutations

Incidental Mutation 'R5431:Sntb1'

428069

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

042847-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5431 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55642795 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 461 (G461R)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	C	16: 88,707,538	S124G	possibly damaging	Het
4921539E11Rik	T	C	4: 103,270,848	T27A	probably benign	Het
Aspg	T	A	12: 112,123,412	N461K	probably benign	Het
B4galnt3	T	A	6: 120,218,967	T300S	probably damaging	Het
BC035044	A	G	6: 128,885,007		probably benign	Het
Bmp5	C	T	9: 75,893,709	P374S	probably damaging	Het
C330018D20Rik	A	T	18: 56,957,856	F78L	probably benign	Het
Cds2	T	A	2: 132,302,170	S289T	probably benign	Het
Cerkl	C	T	2: 79,341,335	C393Y	probably damaging	Het
Ciita	C	T	16: 10,523,792	R1020C	probably damaging	Het
Dcaf13	C	A	15: 39,123,224	D130E	probably benign	Het
Dnal4	C	T	15: 79,762,447	G50R	probably damaging	Het
Elfn1	A	G	5: 139,971,568	N109S	probably damaging	Het
Ep400	A	G	5: 110,676,554	V2435A	unknown	Het
Fam178b	T	C	1: 36,632,485	E185G	probably damaging	Het
Fam227b	C	A	2: 126,126,931	L74F	probably benign	Het
Fam92b	C	A	8: 120,167,303		probably null	Het
Fgfr4	G	A	13: 55,156,651	V138I	probably benign	Het
Flnc	A	G	6: 29,456,384	I2161V	possibly damaging	Het
Frmd5	T	C	2: 121,562,909	N235S	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ggt6	A	G	11: 72,437,738	T355A	possibly damaging	Het
Gm14393	G	A	2: 175,063,876	T41I	probably damaging	Het
Gpr151	A	C	18: 42,578,867	S249A	probably damaging	Het
Gpr152	T	A	19: 4,143,747	V429D	probably benign	Het
Grm7	G	A	6: 111,358,426	M599I	probably benign	Het
Hdac4	T	A	1: 91,972,790	R54*	probably null	Het
Ice1	A	G	13: 70,592,650	L2146S	probably damaging	Het
Igfbpl1	C	T	4: 45,815,588	V183I	probably benign	Het
Kel	G	A	6: 41,698,420	S299F	probably benign	Het
Kif14	T	C	1: 136,496,695	I1016T	possibly damaging	Het
Lhx3	T	C	2: 26,201,118	D395G	probably damaging	Het
Micu1	T	C	10: 59,750,521	Y140H	possibly damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nbn	C	T	4: 15,986,593	H665Y	probably benign	Het
Pkhd1	G	T	1: 20,117,836	T3416K	probably benign	Het
Plxnb1	T	C	9: 109,100,772	F232S	probably damaging	Het
Pus7l	T	C	15: 94,529,486	N472D	probably damaging	Het
Rfx1	C	T	8: 84,082,720	Q225*	probably null	Het
Rnase2a	T	C	14: 51,255,563	Y115C	possibly damaging	Het
Ryr1	T	A	7: 29,109,812	D386V	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sgcz	T	A	8: 37,639,984	T125S	probably damaging	Het
Syt2	A	G	1: 134,740,957	S36G	probably benign	Het
Tcaf3	A	G	6: 42,597,185	L31P	probably damaging	Het
Tenm3	C	A	8: 48,367,377	E142*	probably null	Het
Tgfbr2	G	T	9: 116,131,601	S94R	probably damaging	Het
Vmn2r12	A	G	5: 109,091,818	I293T	probably damaging	Het
Wrap73	G	A	4: 154,145,274	R34Q	probably damaging	Het
Zc3h14	A	G	12: 98,780,065	D511G	possibly damaging	Het
Zcchc11	T	A	4: 108,491,412	I297N	probably damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TAAGTAGTCAGGCCGCCTAC -3'
(R):5'- GTTAATAAGAAATTCGTGGCTGGGC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTCATTGCACATG -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'

Posted On

2016-09-01