Incidental Mutation 'R5431:Dnal4'
ID428070
Institutional Source Beutler Lab
Gene Symbol Dnal4
Ensembl Gene ENSMUSG00000022420
Gene Namedynein, axonemal, light chain 4
SynonymsD15Ertd424e, Dnalc4
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79761453-79777849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79762447 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 50 (G50R)
Ref Sequence ENSEMBL: ENSMUSP00000155613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023055] [ENSMUST00000069877] [ENSMUST00000162713] [ENSMUST00000229644] [ENSMUST00000230645]
Predicted Effect probably damaging
Transcript: ENSMUST00000023055
AA Change: G78R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023055
Gene: ENSMUSG00000022420
AA Change: G78R

DomainStartEndE-ValueType
Pfam:Dynein_light 15 105 5.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069877
AA Change: G78R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070325
Gene: ENSMUSG00000022420
AA Change: G78R

DomainStartEndE-ValueType
Dynein_light 15 93 1.24e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162713
AA Change: G78R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229644
AA Change: G50R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230645
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Dnal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Dnal4 APN 15 79762405 missense probably damaging 0.98
IGL02726:Dnal4 APN 15 79763544 missense probably damaging 1.00
PIT4362001:Dnal4 UTSW 15 79763565 missense probably benign
R0926:Dnal4 UTSW 15 79762025 missense probably benign
R5134:Dnal4 UTSW 15 79763565 missense possibly damaging 0.89
R6248:Dnal4 UTSW 15 79762513 missense probably damaging 0.97
R8040:Dnal4 UTSW 15 79761968 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTCACCAAGTGGACACTCTG -3'
(R):5'- TTTCTGCCTAGAGCTCAGTGC -3'

Sequencing Primer
(F):5'- CAAAAGAAAAGACTTGACTCTCCTTG -3'
(R):5'- TAGAGCTCAGTGCCACGCTTC -3'
Posted On2016-09-01