Incidental Mutation 'R5431:Gpr151'
ID 428074
Institutional Source Beutler Lab
Gene Symbol Gpr151
Ensembl Gene ENSMUSG00000042816
Gene Name G protein-coupled receptor 151
Synonyms GalRL, PGR7, C130082O03Rik
MMRRC Submission 042847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5431 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 42710946-42712717 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 42711932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 249 (S249A)
Ref Sequence ENSEMBL: ENSMUSP00000058887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000054738] [ENSMUST00000173642]
AlphaFold Q7TSN6
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054738
AA Change: S249A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058887
Gene: ENSMUSG00000042816
AA Change: S249A

DomainStartEndE-ValueType
Pfam:7tm_1 57 310 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184771
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the galanin receptor subfamily of G protein-coupled receptors. The encoded protein is found predominantly in the central nervous system. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,504,426 (GRCm39) S124G possibly damaging Het
4921539E11Rik T C 4: 103,128,045 (GRCm39) T27A probably benign Het
Aspg T A 12: 112,089,846 (GRCm39) N461K probably benign Het
B4galnt3 T A 6: 120,195,928 (GRCm39) T300S probably damaging Het
BC035044 A G 6: 128,861,970 (GRCm39) probably benign Het
Bmp5 C T 9: 75,800,991 (GRCm39) P374S probably damaging Het
C330018D20Rik A T 18: 57,090,928 (GRCm39) F78L probably benign Het
Cds2 T A 2: 132,144,090 (GRCm39) S289T probably benign Het
Cerkl C T 2: 79,171,679 (GRCm39) C393Y probably damaging Het
Cibar2 C A 8: 120,894,042 (GRCm39) probably null Het
Ciita C T 16: 10,341,656 (GRCm39) R1020C probably damaging Het
Dcaf13 C A 15: 38,986,619 (GRCm39) D130E probably benign Het
Dnal4 C T 15: 79,646,648 (GRCm39) G50R probably damaging Het
Elfn1 A G 5: 139,957,323 (GRCm39) N109S probably damaging Het
Ep400 A G 5: 110,824,420 (GRCm39) V2435A unknown Het
Fam178b T C 1: 36,671,566 (GRCm39) E185G probably damaging Het
Fam227b C A 2: 125,968,851 (GRCm39) L74F probably benign Het
Fgfr4 G A 13: 55,304,464 (GRCm39) V138I probably benign Het
Flnc A G 6: 29,456,383 (GRCm39) I2161V possibly damaging Het
Frmd5 T C 2: 121,393,390 (GRCm39) N235S probably damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Ggt6 A G 11: 72,328,564 (GRCm39) T355A possibly damaging Het
Gm14393 G A 2: 174,905,669 (GRCm39) T41I probably damaging Het
Gpr152 T A 19: 4,193,746 (GRCm39) V429D probably benign Het
Grm7 G A 6: 111,335,387 (GRCm39) M599I probably benign Het
Hdac4 T A 1: 91,900,512 (GRCm39) R54* probably null Het
Ice1 A G 13: 70,740,769 (GRCm39) L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 (GRCm39) V183I probably benign Het
Kel G A 6: 41,675,354 (GRCm39) S299F probably benign Het
Kif14 T C 1: 136,424,433 (GRCm39) I1016T possibly damaging Het
Lhx3 T C 2: 26,091,130 (GRCm39) D395G probably damaging Het
Micu1 T C 10: 59,586,343 (GRCm39) Y140H possibly damaging Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Nbn C T 4: 15,986,593 (GRCm39) H665Y probably benign Het
Pkhd1 G T 1: 20,188,060 (GRCm39) T3416K probably benign Het
Plxnb1 T C 9: 108,929,840 (GRCm39) F232S probably damaging Het
Pus7l T C 15: 94,427,367 (GRCm39) N472D probably damaging Het
Rfx1 C T 8: 84,809,349 (GRCm39) Q225* probably null Het
Rnase2a T C 14: 51,493,020 (GRCm39) Y115C possibly damaging Het
Ryr1 T A 7: 28,809,237 (GRCm39) D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Homo
Sgcz T A 8: 38,107,138 (GRCm39) T125S probably damaging Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Syt2 A G 1: 134,668,695 (GRCm39) S36G probably benign Het
Tcaf3 A G 6: 42,574,119 (GRCm39) L31P probably damaging Het
Tenm3 C A 8: 48,820,412 (GRCm39) E142* probably null Het
Tgfbr2 G T 9: 115,960,669 (GRCm39) S94R probably damaging Het
Tut4 T A 4: 108,348,609 (GRCm39) I297N probably damaging Het
Vmn2r12 A G 5: 109,239,684 (GRCm39) I293T probably damaging Het
Wrap73 G A 4: 154,229,731 (GRCm39) R34Q probably damaging Het
Zc3h14 A G 12: 98,746,324 (GRCm39) D511G possibly damaging Het
Other mutations in Gpr151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Gpr151 APN 18 42,711,835 (GRCm39) missense probably benign 0.03
IGL03167:Gpr151 APN 18 42,711,439 (GRCm39) missense probably benign 0.06
R1561:Gpr151 UTSW 18 42,712,221 (GRCm39) missense probably benign 0.42
R3875:Gpr151 UTSW 18 42,711,661 (GRCm39) missense probably benign 0.02
R4294:Gpr151 UTSW 18 42,711,602 (GRCm39) missense probably benign 0.00
R5188:Gpr151 UTSW 18 42,711,820 (GRCm39) missense probably benign
R5815:Gpr151 UTSW 18 42,712,450 (GRCm39) missense probably benign 0.00
R6199:Gpr151 UTSW 18 42,711,619 (GRCm39) missense probably benign 0.31
R6302:Gpr151 UTSW 18 42,712,459 (GRCm39) missense probably damaging 1.00
R6891:Gpr151 UTSW 18 42,711,985 (GRCm39) missense probably benign 0.15
R7180:Gpr151 UTSW 18 42,712,021 (GRCm39) nonsense probably null
R8262:Gpr151 UTSW 18 42,711,437 (GRCm39) nonsense probably null
R9328:Gpr151 UTSW 18 42,712,270 (GRCm39) missense probably damaging 0.98
R9421:Gpr151 UTSW 18 42,712,220 (GRCm39) missense probably benign 0.00
R9524:Gpr151 UTSW 18 42,712,710 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGCCTTTCAAGCCTGCC -3'
(R):5'- AATGTGCCTCGTGGATGTGC -3'

Sequencing Primer
(F):5'- GCCTTGAACTCTTCAGACATAACTAG -3'
(R):5'- CCAGCTGTGGCAGAAGAATTC -3'
Posted On 2016-09-01