Incidental Mutation 'R5432:Gm14139'
ID428083
Institutional Source Beutler Lab
Gene Symbol Gm14139
Ensembl Gene ENSMUSG00000079009
Gene Namepredicted gene 14139
Synonyms
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5432 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150181755-150193279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150191981 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 74 (N74S)
Ref Sequence ENSEMBL: ENSMUSP00000105552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109926] [ENSMUST00000109929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109926
AA Change: N74S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009
AA Change: N74S

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109929
AA Change: N105S

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105555
Gene: ENSMUSG00000079009
AA Change: N105S

DomainStartEndE-ValueType
KRAB 3 65 1.65e-15 SMART
ZnF_C2H2 102 124 8.6e-5 SMART
ZnF_C2H2 130 152 1.76e-1 SMART
ZnF_C2H2 158 180 3.02e0 SMART
ZnF_C2H2 214 236 6.08e-5 SMART
ZnF_C2H2 242 264 1.04e-3 SMART
ZnF_C2H2 270 292 2.57e-3 SMART
ZnF_C2H2 298 320 1.06e-4 SMART
ZnF_C2H2 326 348 2.2e-2 SMART
ZnF_C2H2 354 376 4.47e-3 SMART
ZnF_C2H2 382 404 7.37e-4 SMART
ZnF_C2H2 410 432 4.24e-4 SMART
ZnF_C2H2 438 460 1.2e-3 SMART
ZnF_C2H2 466 488 2.61e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Gm14139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Gm14139 UTSW 2 150191864 missense possibly damaging 0.78
R0505:Gm14139 UTSW 2 150193080 nonsense probably null
R0562:Gm14139 UTSW 2 150192574 missense probably damaging 1.00
R1239:Gm14139 UTSW 2 150191971 missense possibly damaging 0.94
R1878:Gm14139 UTSW 2 150193069 missense probably damaging 1.00
R1966:Gm14139 UTSW 2 150191907 missense probably benign 0.00
R2001:Gm14139 UTSW 2 150192947 missense probably benign 0.00
R2208:Gm14139 UTSW 2 150193145 missense probably benign 0.40
R3110:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R3112:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R4135:Gm14139 UTSW 2 150181868 splice site probably benign
R4299:Gm14139 UTSW 2 150190733 missense probably damaging 1.00
R4579:Gm14139 UTSW 2 150192223 missense probably damaging 1.00
R4818:Gm14139 UTSW 2 150192061 missense probably damaging 1.00
R4894:Gm14139 UTSW 2 150191979 nonsense probably null
R5669:Gm14139 UTSW 2 150192178 missense probably benign 0.09
R6106:Gm14139 UTSW 2 150192805 missense probably damaging 1.00
R6857:Gm14139 UTSW 2 150192062 missense probably damaging 1.00
R7450:Gm14139 UTSW 2 150193126 missense probably benign 0.04
R8011:Gm14139 UTSW 2 150192346 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTGTGGTAAAGTTCTTCCTGT -3'
(R):5'- CTTTGTCACAATGCTTACATTCATAGG -3'

Sequencing Primer
(F):5'- CCACCTCTTATAGTTGAAAGGTGCTG -3'
(R):5'- ACATTCATAGGGTTTCTCTCCAGTG -3'
Posted On2016-09-01