Incidental Mutation 'R5432:Hrc'
ID428091
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5432 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45336861 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 479 (H479N)
Ref Sequence ENSEMBL: ENSMUSP00000082459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085351
AA Change: H479N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: H479N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211411
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
BB004:Hrc UTSW 7 45336053 missense possibly damaging 0.53
BB014:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5245:Hrc UTSW 7 45335431 missense probably damaging 1.00
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 unclassified probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R6887:Hrc UTSW 7 45335664 missense probably benign 0.18
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7208:Hrc UTSW 7 45336565 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
R7456:Hrc UTSW 7 45336896 missense possibly damaging 0.83
R7525:Hrc UTSW 7 45336379 missense probably benign
R7673:Hrc UTSW 7 45337234 missense probably benign 0.00
R7734:Hrc UTSW 7 45336676 missense probably benign 0.06
R7927:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R7952:Hrc UTSW 7 45336268 missense probably damaging 0.98
R8080:Hrc UTSW 7 45336838 missense probably damaging 0.96
Z1177:Hrc UTSW 7 45336970 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CACCATGATCTTGGACGTGAG -3'
(R):5'- TCATCTTCCTGGCTCATGGG -3'

Sequencing Primer
(F):5'- CATGATCTTGGACGTGAGAGTGAAG -3'
(R):5'- ACTATGGGCTTGCCTCTGC -3'
Posted On2016-09-01