Incidental Mutation 'R5432:Bahcc1'
Institutional Source Beutler Lab
Gene Symbol Bahcc1
Ensembl Gene ENSMUSG00000039741
Gene NameBAH domain and coiled-coil containing 1
MMRRC Submission 042997-MU
Accession Numbers

Genbank: NM_198423; MGI: 2679272

Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R5432 (G1)
Quality Score147
Status Not validated
Chromosomal Location120232947-120292296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120287988 bp
Amino Acid Change Serine to Proline at position 2458 (S2458P)
Ref Sequence ENSEMBL: ENSMUSP00000112827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044985] [ENSMUST00000118987] [ENSMUST00000122148]
Predicted Effect probably benign
Transcript: ENSMUST00000044985
AA Change: S2458P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043643
Gene: ENSMUSG00000039741
AA Change: S2458P

low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118987
AA Change: S2458P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112784
Gene: ENSMUSG00000039741
AA Change: S2458P

low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122148
AA Change: S2458P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112827
Gene: ENSMUSG00000039741
AA Change: S2458P

low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143667
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality for the majority of mutants. Those that survive exhibit hind leg motor dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(2) Gene trapped(24)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Bahcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bahcc1 APN 11 120272304 missense probably damaging 1.00
IGL00536:Bahcc1 APN 11 120285045 missense probably damaging 0.96
IGL01339:Bahcc1 APN 11 120289512 missense probably damaging 1.00
IGL01695:Bahcc1 APN 11 120276609 missense probably benign 0.02
IGL01744:Bahcc1 APN 11 120271737 missense probably benign 0.02
IGL01769:Bahcc1 APN 11 120280204 splice site probably benign
IGL01982:Bahcc1 APN 11 120287473 missense probably damaging 1.00
IGL02341:Bahcc1 APN 11 120272520 missense probably damaging 1.00
IGL02535:Bahcc1 APN 11 120287536 missense possibly damaging 0.88
IGL02559:Bahcc1 APN 11 120285172 missense probably damaging 0.97
IGL02579:Bahcc1 APN 11 120285349 splice site probably benign
IGL02609:Bahcc1 APN 11 120289398 missense possibly damaging 0.93
IGL02678:Bahcc1 APN 11 120272871 missense probably damaging 1.00
IGL02800:Bahcc1 APN 11 120272934 missense probably damaging 1.00
IGL02963:Bahcc1 APN 11 120274932 missense possibly damaging 0.86
IGL03128:Bahcc1 APN 11 120268434 splice site probably benign
IGL03242:Bahcc1 APN 11 120268300 splice site probably benign
IGL03248:Bahcc1 APN 11 120268409 missense probably damaging 1.00
Dimensionality UTSW 11 120273009 missense probably damaging 1.00
G1citation:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R0019:Bahcc1 UTSW 11 120289771 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0148:Bahcc1 UTSW 11 120268404 missense probably damaging 1.00
R0164:Bahcc1 UTSW 11 120285074 splice site probably benign
R0321:Bahcc1 UTSW 11 120273425 critical splice donor site probably null
R0671:Bahcc1 UTSW 11 120287320 missense probably damaging 1.00
R0737:Bahcc1 UTSW 11 120272841 missense probably damaging 1.00
R1452:Bahcc1 UTSW 11 120282239 splice site probably benign
R1570:Bahcc1 UTSW 11 120272183 missense possibly damaging 0.74
R1914:Bahcc1 UTSW 11 120285399 missense probably damaging 1.00
R2010:Bahcc1 UTSW 11 120272778 missense probably damaging 1.00
R2075:Bahcc1 UTSW 11 120271689 missense probably damaging 1.00
R2085:Bahcc1 UTSW 11 120288082 missense probably damaging 1.00
R3552:Bahcc1 UTSW 11 120276772 missense possibly damaging 0.90
R3711:Bahcc1 UTSW 11 120275097 missense probably benign 0.27
R3804:Bahcc1 UTSW 11 120283358 missense probably benign 0.01
R4349:Bahcc1 UTSW 11 120259201 missense probably damaging 1.00
R4557:Bahcc1 UTSW 11 120275088 missense probably damaging 1.00
R4801:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4802:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4908:Bahcc1 UTSW 11 120287754 missense probably benign 0.36
R4941:Bahcc1 UTSW 11 120286665 missense probably benign
R5217:Bahcc1 UTSW 11 120274459 nonsense probably null
R5241:Bahcc1 UTSW 11 120271403 missense probably damaging 1.00
R5696:Bahcc1 UTSW 11 120273987 missense probably damaging 1.00
R5724:Bahcc1 UTSW 11 120285366 missense possibly damaging 0.78
R5725:Bahcc1 UTSW 11 120274888 missense probably benign
R5788:Bahcc1 UTSW 11 120286352 missense probably damaging 1.00
R5893:Bahcc1 UTSW 11 120285430 missense probably damaging 0.99
R5900:Bahcc1 UTSW 11 120284493 missense probably damaging 1.00
R6014:Bahcc1 UTSW 11 120289789 missense probably benign 0.00
R6058:Bahcc1 UTSW 11 120287385 missense probably damaging 1.00
R6107:Bahcc1 UTSW 11 120272888 missense probably benign 0.00
R6302:Bahcc1 UTSW 11 120276808 missense probably damaging 1.00
R6525:Bahcc1 UTSW 11 120285222 missense probably damaging 1.00
R6550:Bahcc1 UTSW 11 120276651 missense possibly damaging 0.94
R6822:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R6836:Bahcc1 UTSW 11 120271757 nonsense probably null
R6846:Bahcc1 UTSW 11 120271596 missense possibly damaging 0.92
R6916:Bahcc1 UTSW 11 120273009 missense probably damaging 1.00
R6966:Bahcc1 UTSW 11 120283159 missense probably damaging 0.99
R7097:Bahcc1 UTSW 11 120272646 missense possibly damaging 0.87
R7289:Bahcc1 UTSW 11 120280174 missense probably benign 0.08
R7441:Bahcc1 UTSW 11 120286306 missense probably damaging 0.99
R7520:Bahcc1 UTSW 11 120276205 missense possibly damaging 0.47
R7556:Bahcc1 UTSW 11 120287763 missense probably damaging 1.00
R7672:Bahcc1 UTSW 11 120283346 missense possibly damaging 0.63
R7791:Bahcc1 UTSW 11 120268377 missense probably damaging 1.00
R7794:Bahcc1 UTSW 11 120272681 nonsense probably null
R7802:Bahcc1 UTSW 11 120274692 missense probably benign 0.03
R7946:Bahcc1 UTSW 11 120272499 missense probably benign
R7985:Bahcc1 UTSW 11 120272891 missense probably damaging 0.97
R8128:Bahcc1 UTSW 11 120272390 nonsense probably null
R8131:Bahcc1 UTSW 11 120272838 missense probably benign 0.01
R8353:Bahcc1 UTSW 11 120274425 missense probably damaging 1.00
R8439:Bahcc1 UTSW 11 120274589 missense probably benign 0.01
X0026:Bahcc1 UTSW 11 120271752 missense probably benign 0.20
Z1176:Bahcc1 UTSW 11 120276609 missense possibly damaging 0.89
Z1176:Bahcc1 UTSW 11 120284394 missense probably benign 0.00
Z1177:Bahcc1 UTSW 11 120272921 missense possibly damaging 0.73
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-09-01