Incidental Mutation 'R5432:Cacna2d3'
ID428115
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 3
Synonymsalpha2delta3, alpha 2 delta-3
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5432 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location28904943-29721864 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 28943555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
Predicted Effect probably null
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225668
Predicted Effect probably null
Transcript: ENSMUST00000225985
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACTAAACTCTTCTATACTCCAGGCTG -3'
(R):5'- AACTGCATCTGAGATGGGTGG -3'

Sequencing Primer
(F):5'- ACTCTTCTATACTCCAGGCTGTATAG -3'
(R):5'- CATCTGAGATGGGTGGTTTGCC -3'
Posted On2016-09-01