Incidental Mutation 'R5432:Samd4'
ID428116
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission 042997-MU
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R5432 (G1)
Quality Score157
Status Not validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47074062 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 279 (Q279R)
Ref Sequence ENSEMBL: ENSMUSP00000153846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000125688] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect probably benign
Transcript: ENSMUST00000022386
AA Change: Q468R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: Q468R

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100672
AA Change: Q380R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838
AA Change: Q380R

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125113
AA Change: Q367R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: Q367R

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125688
AA Change: Q59R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115569
Gene: ENSMUSG00000021838
AA Change: Q59R

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137543
AA Change: Q380R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838
AA Change: Q380R

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227848
Predicted Effect probably benign
Transcript: ENSMUST00000228404
AA Change: Q279R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAGCTACATCAGATGATCC -3'
(R):5'- TTCTGTAGGGGTGCTAACGC -3'

Sequencing Primer
(F):5'- GAGCTACATCAGATGATCCTGACAC -3'
(R):5'- GTGGTTACGGAAACTCATTCTACGC -3'
Posted On2016-09-01