Incidental Mutation 'R5432:Nynrin'
ID428117
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5432 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55864466 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 531 (T531A)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100529
AA Change: T531A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: T531A

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168479
AA Change: T531A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: T531A

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181218
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CAGTTTATCGGTGGTGCCAG -3'
(R):5'- TCACTGAAGGTGTTTTCTGAGC -3'

Sequencing Primer
(F):5'- TTGTGGTATCAAAGAGAAGGTTAGCC -3'
(R):5'- CACTGAAGGTGTTTTCTGAGCTGTAG -3'
Posted On2016-09-01