Incidental Mutation 'R5433:Tctex1d1'
ID428143
Institutional Source Beutler Lab
Gene Symbol Tctex1d1
Ensembl Gene ENSMUSG00000028523
Gene NameTctex1 domain containing 1
Synonyms
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location102978606-103005594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103002503 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000152761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030248] [ENSMUST00000116317] [ENSMUST00000125417] [ENSMUST00000140654] [ENSMUST00000169211] [ENSMUST00000223169]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030248
AA Change: E80G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030248
Gene: ENSMUSG00000028523
AA Change: E80G

DomainStartEndE-ValueType
Pfam:Tctex-1 74 171 9.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116317
AA Change: E80G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112019
Gene: ENSMUSG00000028523
AA Change: E80G

DomainStartEndE-ValueType
Pfam:Tctex-1 72 172 7.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125417
AA Change: E23G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117319
Gene: ENSMUSG00000028523
AA Change: E23G

DomainStartEndE-ValueType
Pfam:Tctex-1 17 114 4.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140654
AA Change: E23G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116692
Gene: ENSMUSG00000028523
AA Change: E23G

DomainStartEndE-ValueType
Pfam:Tctex-1 15 99 4.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148892
Predicted Effect possibly damaging
Transcript: ENSMUST00000169211
AA Change: E80G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128228
Gene: ENSMUSG00000028523
AA Change: E80G

DomainStartEndE-ValueType
Pfam:Tctex-1 15 115 3.3e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223169
AA Change: E84G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Tctex1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Tctex1d1 APN 4 102988606 missense probably benign 0.00
IGL02813:Tctex1d1 APN 4 102992572 missense probably damaging 1.00
IGL03022:Tctex1d1 APN 4 103002517 missense probably benign 0.00
R0127:Tctex1d1 UTSW 4 103002452 splice site probably benign
R0685:Tctex1d1 UTSW 4 103002538 missense probably damaging 1.00
R4695:Tctex1d1 UTSW 4 103004229 missense probably damaging 0.98
R5274:Tctex1d1 UTSW 4 103002571 missense possibly damaging 0.85
R5950:Tctex1d1 UTSW 4 103004250 missense probably damaging 1.00
R6196:Tctex1d1 UTSW 4 102992569 missense possibly damaging 0.89
R6245:Tctex1d1 UTSW 4 102988667 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGGGAGCCTGGTAAATTCG -3'
(R):5'- TGTGCCATTGAACTGATCCTG -3'

Sequencing Primer
(F):5'- GAAAAGCCTGACCCTAATTGTG -3'
(R):5'- GTGCCATTGAACTGATCCTGAAAATG -3'
Posted On2016-09-01