Incidental Mutation 'R5433:Aacs'
ID428149
Institutional Source Beutler Lab
Gene Symbol Aacs
Ensembl Gene ENSMUSG00000029482
Gene Nameacetoacetyl-CoA synthetase
Synonyms2210408B16Rik
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125475814-125517410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125515014 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 589 (M589L)
Ref Sequence ENSEMBL: ENSMUSP00000031445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031445]
Predicted Effect probably benign
Transcript: ENSMUST00000031445
AA Change: M589L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031445
Gene: ENSMUSG00000029482
AA Change: M589L

DomainStartEndE-ValueType
Pfam:ACAS_N 47 105 1.1e-11 PFAM
Pfam:AMP-binding 103 546 1.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200286
Meta Mutation Damage Score 0.1479 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Aacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Aacs APN 5 125514190 missense probably benign 0.00
IGL00155:Aacs APN 5 125513171 missense probably damaging 1.00
IGL00906:Aacs APN 5 125503274 missense probably benign 0.00
IGL00910:Aacs APN 5 125508708 missense probably benign 0.00
IGL01613:Aacs APN 5 125512652 missense possibly damaging 0.48
IGL01796:Aacs APN 5 125513209 missense probably damaging 1.00
IGL02155:Aacs APN 5 125506286 missense probably null 1.00
IGL02585:Aacs APN 5 125515057 missense possibly damaging 0.78
IGL03218:Aacs APN 5 125484663 splice site probably null
PIT4283001:Aacs UTSW 5 125484655 missense probably damaging 0.99
R0328:Aacs UTSW 5 125516259 missense probably benign 0.00
R1478:Aacs UTSW 5 125503223 missense possibly damaging 0.94
R1511:Aacs UTSW 5 125514977 missense probably benign 0.00
R1544:Aacs UTSW 5 125516330 missense possibly damaging 0.82
R1616:Aacs UTSW 5 125484526 splice site probably null
R1709:Aacs UTSW 5 125489878 missense probably benign 0.00
R1725:Aacs UTSW 5 125482935 critical splice donor site probably null
R2424:Aacs UTSW 5 125513095 splice site probably null
R2472:Aacs UTSW 5 125506252 missense probably damaging 1.00
R3612:Aacs UTSW 5 125503187 missense probably damaging 1.00
R3732:Aacs UTSW 5 125506262 missense probably damaging 0.99
R3766:Aacs UTSW 5 125506262 missense probably damaging 0.99
R4740:Aacs UTSW 5 125506252 missense probably damaging 1.00
R4911:Aacs UTSW 5 125506160 missense possibly damaging 0.68
R5477:Aacs UTSW 5 125511920 missense probably damaging 1.00
R5863:Aacs UTSW 5 125503223 missense possibly damaging 0.88
R6919:Aacs UTSW 5 125506163 missense probably benign 0.35
R6943:Aacs UTSW 5 125506298 critical splice donor site probably null
R7543:Aacs UTSW 5 125482856 missense probably damaging 1.00
R7874:Aacs UTSW 5 125506207 missense possibly damaging 0.60
R7923:Aacs UTSW 5 125511884 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCAGCTGTAGTATTGCC -3'
(R):5'- TAGGCAACGTGGTACCCATATAG -3'

Sequencing Primer
(F):5'- CAGCTGTAGTATTGCCCAGGTG -3'
(R):5'- CGTGGTACCCATATAGAAGCAAG -3'
Posted On2016-09-01