Incidental Mutation 'R5433:Gm1966'
ID428155
Institutional Source Beutler Lab
Gene Symbol Gm1966
Ensembl Gene ENSMUSG00000073902
Gene Namepredicted gene 1966
Synonyms
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106596743-106604035 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 106600107 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184540
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Gm1966
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Gm1966 APN 7 106602035 missense probably benign 0.10
IGL01410:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01415:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01538:Gm1966 APN 7 106602537 missense probably damaging 0.96
IGL01751:Gm1966 APN 7 106602309 missense possibly damaging 0.80
IGL01916:Gm1966 APN 7 106601826 missense probably benign 0.28
IGL02171:Gm1966 APN 7 106601341 exon noncoding transcript
IGL02550:Gm1966 APN 7 106601639 exon noncoding transcript
H8562:Gm1966 UTSW 7 106603149 missense probably damaging 1.00
R0016:Gm1966 UTSW 7 106603246 missense probably benign 0.00
R0178:Gm1966 UTSW 7 106601821 missense probably damaging 1.00
R0420:Gm1966 UTSW 7 106603883 missense probably damaging 1.00
R0658:Gm1966 UTSW 7 106602886 missense possibly damaging 0.89
R1378:Gm1966 UTSW 7 106602166 missense probably damaging 0.97
R1506:Gm1966 UTSW 7 106601581 missense probably benign 0.08
R1628:Gm1966 UTSW 7 106603269 nonsense probably null
R1834:Gm1966 UTSW 7 106603776 missense possibly damaging 0.79
R1888:Gm1966 UTSW 7 106597423 exon noncoding transcript
R2145:Gm1966 UTSW 7 106603008 missense possibly damaging 0.84
R4056:Gm1966 UTSW 7 106604009 missense possibly damaging 0.59
R4067:Gm1966 UTSW 7 106599565 exon noncoding transcript
R4631:Gm1966 UTSW 7 106599523 exon noncoding transcript
R4817:Gm1966 UTSW 7 106601230 exon noncoding transcript
R4900:Gm1966 UTSW 7 106598586 exon noncoding transcript
R4970:Gm1966 UTSW 7 106600657 exon noncoding transcript
R5009:Gm1966 UTSW 7 106601560 exon noncoding transcript
R5050:Gm1966 UTSW 7 106596972 exon noncoding transcript
R5086:Gm1966 UTSW 7 106598027 exon noncoding transcript
R5090:Gm1966 UTSW 7 106600902 exon noncoding transcript
R5168:Gm1966 UTSW 7 106596847 exon noncoding transcript
R5260:Gm1966 UTSW 7 106599204 exon noncoding transcript
R5331:Gm1966 UTSW 7 106598751 exon noncoding transcript
R5389:Gm1966 UTSW 7 106598235 exon noncoding transcript
R5488:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5489:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5504:Gm1966 UTSW 7 106602744 exon noncoding transcript
R5956:Gm1966 UTSW 7 106601470 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCCGGTGTTCTATTGTCAGG -3'
(R):5'- GCTCGAGAACAAGGATTCCTTATTG -3'

Sequencing Primer
(F):5'- CCGGTGTTCTATTGTCAGGTTGTC -3'
(R):5'- TCCTTATTGATGAAGACCAGAGAGAC -3'
Posted On2016-09-01