Mutagenetix > Incidental Mutations

Incidental Mutation 'R5433:Slc22a3'

428171

Institutional Source

Beutler Lab

Gene Symbol

Slc22a3

Ensembl Gene

ENSMUSG00000023828

Gene Name

solute carrier family 22 (organic cation transporter), member 3

Synonyms

Oct3, EMT, Orct3

MMRRC Submission

042998-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12419972-12507704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12458490 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 264 (G264S)

Ref Sequence

ENSEMBL: ENSMUSP00000024595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024595]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024595
AA Change: G264S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: G264S

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:Sugar_tr	105	526	1.2e-28	PFAM
Pfam:MFS_1	144	395	3.3e-22	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,498	S24G	probably damaging	Het
1810064F22Rik	A	G	9: 22,207,743		noncoding transcript	Het
Aacs	A	T	5: 125,515,014	M589L	probably benign	Het
Adamts8	A	C	9: 30,961,716	H739P	probably benign	Het
Atp8b2	T	C	3: 89,952,909		probably benign	Het
BC030500	A	G	8: 58,913,009		probably benign	Het
Btnl9	T	A	11: 49,176,003		probably benign	Het
Cd74	G	T	18: 60,807,921	A31S	probably benign	Het
Ceacam3	G	A	7: 17,159,883	A440T	possibly damaging	Het
Ces1d	G	A	8: 93,186,036	T258I	probably benign	Het
Col10a1	A	G	10: 34,390,739		probably benign	Het
Coro1b	C	T	19: 4,153,450	A430V	probably benign	Het
Cyp2c65	A	T	19: 39,093,484	I485L	probably benign	Het
Dio1	A	T	4: 107,306,780		probably benign	Het
Dmxl1	G	A	18: 49,867,899		probably null	Het
Elp6	A	G	9: 110,315,783	Y136C	probably damaging	Het
Gm1966	T	A	7: 106,600,107		noncoding transcript	Het
Gon4l	A	T	3: 88,896,225	Q1382L	possibly damaging	Het
Guca1a	T	C	17: 47,400,370	E17G	probably damaging	Het
Gucy2d	G	A	7: 98,449,775	G267E	probably damaging	Het
Hspg2	T	A	4: 137,528,794		probably null	Het
Il1a	G	T	2: 129,307,901	D26E	possibly damaging	Het
Iltifb	T	A	10: 118,294,884	I36F	probably damaging	Het
Kcna1	A	T	6: 126,643,112	F82I	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lamtor5	T	G	3: 107,282,007	C120G	probably benign	Het
Lars	A	G	18: 42,251,298	C72R	possibly damaging	Het
Lrrfip1	T	G	1: 91,087,126		probably null	Het
Mapkapk3	T	C	9: 107,256,292	D349G	probably damaging	Het
Mknk2	A	T	10: 80,667,225	I421N	probably benign	Het
Myh6	A	G	14: 54,953,924	I820T	probably benign	Het
Notch2	T	G	3: 98,126,134	V1182G	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr30	C	T	11: 58,455,854	V32M	probably damaging	Het
Olfr366	T	G	2: 37,219,672	F61C	probably damaging	Het
Ppfia4	A	T	1: 134,317,894	S641T	probably damaging	Het
Prok1	T	A	3: 107,239,633	H6L	probably benign	Het
Ptprm	A	T	17: 66,693,473	V1172E	probably damaging	Het
Rasal3	C	T	17: 32,393,601	R762Q	probably benign	Het
Rgs20	G	T	1: 5,070,110	A23E	possibly damaging	Het
Rprd1a	T	C	18: 24,507,231	T163A	probably benign	Het
Rrm1	A	T	7: 102,465,767	N37I	probably damaging	Het
Shc4	T	A	2: 125,639,430	E520V	probably damaging	Het
Slc14a2	G	T	18: 78,208,928	P56Q	probably damaging	Het
Svil	A	G	18: 5,059,294	E770G	probably damaging	Het
Svop	A	G	5: 114,060,125	V129A	probably damaging	Het
Szt2	A	T	4: 118,375,466		probably benign	Het
Tcof1	T	C	18: 60,818,033		probably benign	Het
Tctex1d1	A	G	4: 103,002,503	E84G	possibly damaging	Het
Tmem30a	T	A	9: 79,780,648	I80F	probably damaging	Het
Vmn2r16	G	T	5: 109,363,842	L638F	probably damaging	Het
Xkr7	T	A	2: 153,054,324	I366N	probably damaging	Het
Zer1	A	G	2: 30,100,986		probably benign	Het

Other mutations in Slc22a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Slc22a3	APN	17	12425610	missense	probably damaging	1.00
IGL01343:Slc22a3	APN	17	12425629	missense	probably damaging	1.00
IGL01621:Slc22a3	APN	17	12458492	missense	probably benign	0.02
IGL02228:Slc22a3	APN	17	12459810	missense	probably damaging	1.00
R0466:Slc22a3	UTSW	17	12458493	nonsense	probably null
R1501:Slc22a3	UTSW	17	12507104	missense	probably benign	0.12
R1688:Slc22a3	UTSW	17	12433807	missense	probably damaging	1.00
R3030:Slc22a3	UTSW	17	12457634	missense	probably benign	0.00
R4604:Slc22a3	UTSW	17	12459771	missense	probably benign	0.38
R4754:Slc22a3	UTSW	17	12507195	missense	probably benign	0.03
R4796:Slc22a3	UTSW	17	12423788	missense	probably damaging	1.00
R4865:Slc22a3	UTSW	17	12464532	missense	probably benign	0.03
R5483:Slc22a3	UTSW	17	12464467	missense	probably damaging	0.99
R5719:Slc22a3	UTSW	17	12423804	missense	probably damaging	1.00
R5750:Slc22a3	UTSW	17	12433508	missense	probably benign	0.01
R5872:Slc22a3	UTSW	17	12433468	missense	probably damaging	1.00
R5988:Slc22a3	UTSW	17	12433895	missense	possibly damaging	0.92
R6197:Slc22a3	UTSW	17	12458551	missense	probably benign	0.00
R7155:Slc22a3	UTSW	17	12433631	missense	possibly damaging	0.83
R7764:Slc22a3	UTSW	17	12458496	missense	probably damaging	1.00
R7775:Slc22a3	UTSW	17	12464463	missense	probably damaging	1.00
R7824:Slc22a3	UTSW	17	12464463	missense	probably damaging	1.00
X0027:Slc22a3	UTSW	17	12458471	missense	possibly damaging	0.91
Z1088:Slc22a3	UTSW	17	12425681	nonsense	probably null
Z1177:Slc22a3	UTSW	17	12507058	missense	probably benign
Z1177:Slc22a3	UTSW	17	12507171	missense	probably damaging	1.00
Z1177:Slc22a3	UTSW	17	12507175	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCAATAATCTCTCTAGGCTG -3'
(R):5'- ACAAGTGTCAAGTCTGTTTGC -3'

Sequencing Primer
(F):5'- CTCTAGTGATGCTCTAAGCCATGG -3'
(R):5'- GCTTTGATGCTAAGAACTTCCC -3'

Posted On

2016-09-01