Incidental Mutation 'R5433:Slc22a3'
ID428171
Institutional Source Beutler Lab
Gene Symbol Slc22a3
Ensembl Gene ENSMUSG00000023828
Gene Namesolute carrier family 22 (organic cation transporter), member 3
SynonymsOct3, EMT, Orct3
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12419972-12507704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12458490 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 264 (G264S)
Ref Sequence ENSEMBL: ENSMUSP00000024595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024595]
Predicted Effect probably damaging
Transcript: ENSMUST00000024595
AA Change: G264S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: G264S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 105 526 1.2e-28 PFAM
Pfam:MFS_1 144 395 3.3e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Slc22a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Slc22a3 APN 17 12425610 missense probably damaging 1.00
IGL01343:Slc22a3 APN 17 12425629 missense probably damaging 1.00
IGL01621:Slc22a3 APN 17 12458492 missense probably benign 0.02
IGL02228:Slc22a3 APN 17 12459810 missense probably damaging 1.00
R0466:Slc22a3 UTSW 17 12458493 nonsense probably null
R1501:Slc22a3 UTSW 17 12507104 missense probably benign 0.12
R1688:Slc22a3 UTSW 17 12433807 missense probably damaging 1.00
R3030:Slc22a3 UTSW 17 12457634 missense probably benign 0.00
R4604:Slc22a3 UTSW 17 12459771 missense probably benign 0.38
R4754:Slc22a3 UTSW 17 12507195 missense probably benign 0.03
R4796:Slc22a3 UTSW 17 12423788 missense probably damaging 1.00
R4865:Slc22a3 UTSW 17 12464532 missense probably benign 0.03
R5483:Slc22a3 UTSW 17 12464467 missense probably damaging 0.99
R5719:Slc22a3 UTSW 17 12423804 missense probably damaging 1.00
R5750:Slc22a3 UTSW 17 12433508 missense probably benign 0.01
R5872:Slc22a3 UTSW 17 12433468 missense probably damaging 1.00
R5988:Slc22a3 UTSW 17 12433895 missense possibly damaging 0.92
R6197:Slc22a3 UTSW 17 12458551 missense probably benign 0.00
R7155:Slc22a3 UTSW 17 12433631 missense possibly damaging 0.83
R7764:Slc22a3 UTSW 17 12458496 missense probably damaging 1.00
R7775:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
R7824:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
X0027:Slc22a3 UTSW 17 12458471 missense possibly damaging 0.91
Z1088:Slc22a3 UTSW 17 12425681 nonsense probably null
Z1177:Slc22a3 UTSW 17 12507058 missense probably benign
Z1177:Slc22a3 UTSW 17 12507171 missense probably damaging 1.00
Z1177:Slc22a3 UTSW 17 12507175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAATAATCTCTCTAGGCTG -3'
(R):5'- ACAAGTGTCAAGTCTGTTTGC -3'

Sequencing Primer
(F):5'- CTCTAGTGATGCTCTAAGCCATGG -3'
(R):5'- GCTTTGATGCTAAGAACTTCCC -3'
Posted On2016-09-01