Incidental Mutation 'R5433:Guca1a'
ID428173
Institutional Source Beutler Lab
Gene Symbol Guca1a
Ensembl Gene ENSMUSG00000023982
Gene Nameguanylate cyclase activator 1a (retina)
SynonymsmGCAP1, Guca1
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47394560-47400584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47400370 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000060027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059348]
Predicted Effect probably damaging
Transcript: ENSMUST00000059348
AA Change: E17G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060027
Gene: ENSMUSG00000023982
AA Change: E17G

DomainStartEndE-ValueType
EFh 55 83 3.01e-5 SMART
EFh 91 119 2.44e-5 SMART
EFh 135 163 5.83e-3 SMART
low complexity region 166 177 N/A INTRINSIC
Meta Mutation Damage Score 0.8378 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a calcium-binding photoreceptor protein. The encoded protein may be involved in modulation of guanylyl cyclase activity, and in turn, the mammalian cone phototransduction cascade. Disruption of this gene results in the retinal degeneration associated with cone dystrophy. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit photoreceptor degeneration and loss of cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Guca1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Guca1a APN 17 47400384 missense probably damaging 0.99
IGL01684:Guca1a APN 17 47395143 missense probably null 0.83
IGL01969:Guca1a APN 17 47400343 missense probably damaging 0.99
IGL02441:Guca1a APN 17 47394653 unclassified probably benign
IGL03273:Guca1a APN 17 47395173 missense probably benign 0.00
R1216:Guca1a UTSW 17 47395712 unclassified probably benign
R1666:Guca1a UTSW 17 47400242 missense probably damaging 1.00
R4849:Guca1a UTSW 17 47394737 missense possibly damaging 0.82
R6996:Guca1a UTSW 17 47395177 missense probably benign 0.05
Z1088:Guca1a UTSW 17 47400410 missense probably benign
Z1176:Guca1a UTSW 17 47400410 missense probably benign
Z1177:Guca1a UTSW 17 47400410 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTGGCTTCTCGAGGTATCC -3'
(R):5'- TTTAGTCCGACTCACAGGGC -3'

Sequencing Primer
(F):5'- TCTCGAGGTATCCCCCAAGAATTATG -3'
(R):5'- CGACTCACAGGGCTGTCTTTG -3'
Posted On2016-09-01