Incidental Mutation 'R5433:Coro1b'
ID428182
Institutional Source Beutler Lab
Gene Symbol Coro1b
Ensembl Gene ENSMUSG00000024835
Gene Namecoronin, actin binding protein 1B
Synonymscoronin 2
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4148619-4154035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4153450 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 430 (A430V)
Ref Sequence ENSEMBL: ENSMUSP00000008893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000025749] [ENSMUST00000061086] [ENSMUST00000118483] [ENSMUST00000123874] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431]
Predicted Effect probably benign
Transcript: ENSMUST00000008893
AA Change: A430V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835
AA Change: A430V

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061086
SMART Domains Protein: ENSMUSP00000053412
Gene: ENSMUSG00000045826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Pfam:PTPRCAP 58 197 8.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123874
SMART Domains Protein: ENSMUSP00000118450
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the coronin family, such as CORO1B, are WD repeat-containing actin-binding proteins that regulate cell motility (Cai et al., 2005 [PubMed 16027158]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Coro1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02986:Coro1b APN 19 4149471 missense possibly damaging 0.93
IGL03411:Coro1b APN 19 4150226 splice site probably benign
R0189:Coro1b UTSW 19 4153251 missense probably damaging 1.00
R0410:Coro1b UTSW 19 4149363 missense probably damaging 1.00
R1165:Coro1b UTSW 19 4149902 missense probably damaging 0.99
R1302:Coro1b UTSW 19 4149377 missense probably damaging 1.00
R1519:Coro1b UTSW 19 4150584 missense possibly damaging 0.95
R4085:Coro1b UTSW 19 4153619 missense probably benign 0.02
R4528:Coro1b UTSW 19 4149981 missense probably benign 0.23
R4692:Coro1b UTSW 19 4149419 missense probably damaging 1.00
R4919:Coro1b UTSW 19 4150710 missense possibly damaging 0.85
R5650:Coro1b UTSW 19 4150611 missense possibly damaging 0.57
R5870:Coro1b UTSW 19 4149385 missense probably damaging 1.00
R6862:Coro1b UTSW 19 4150771 missense probably benign 0.32
R7332:Coro1b UTSW 19 4149357 missense probably benign 0.00
R7511:Coro1b UTSW 19 4152526 missense probably damaging 1.00
R7559:Coro1b UTSW 19 4150221 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTTGAAGCAGAGGATTGGG -3'
(R):5'- TGGTGGTCCTATGTATCCCC -3'

Sequencing Primer
(F):5'- GTGAGCGGTCAGGATGCTAATC -3'
(R):5'- TTGACCAGCATCCGGAGTG -3'
Posted On2016-09-01