Incidental Mutation 'R5434:Rbm15'
ID428196
Institutional Source Beutler Lab
Gene Symbol Rbm15
Ensembl Gene ENSMUSG00000048109
Gene NameRNA binding motif protein 15
Synonyms
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107325421-107333673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107330467 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 872 (S872P)
Ref Sequence ENSEMBL: ENSMUSP00000054424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061772
AA Change: S872P

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054424
Gene: ENSMUSG00000048109
AA Change: S872P

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 56 96 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 133 163 N/A INTRINSIC
RRM 170 247 7.49e-5 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
RRM 374 446 1.33e-10 SMART
RRM 455 524 2.51e-6 SMART
low complexity region 532 542 N/A INTRINSIC
low complexity region 564 582 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
internal_repeat_2 613 685 7.13e-5 PROSPERO
internal_repeat_2 677 753 7.13e-5 PROSPERO
low complexity region 754 771 N/A INTRINSIC
Pfam:SPOC 789 925 1.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197769
Meta Mutation Damage Score 0.0990 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality around E9.5. Mice homozygous for a floxed allele activate in hematopoietic cells exhibit increased megakaryocyte cell number, long-term hematopoietic stem cells, and red pulp as well as decreased B cells and leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Rbm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rbm15 APN 3 107331010 missense probably damaging 0.98
IGL01933:Rbm15 APN 3 107331103 missense probably damaging 0.99
IGL02116:Rbm15 APN 3 107330280 missense probably damaging 1.00
IGL02886:Rbm15 APN 3 107326295 missense probably benign 0.41
R0281:Rbm15 UTSW 3 107331155 missense probably damaging 0.99
R0374:Rbm15 UTSW 3 107330564 missense probably damaging 1.00
R0376:Rbm15 UTSW 3 107330938 missense probably benign 0.00
R0501:Rbm15 UTSW 3 107332530 missense possibly damaging 0.91
R0517:Rbm15 UTSW 3 107331369 missense probably damaging 1.00
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1348:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1372:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1373:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1377:Rbm15 UTSW 3 107330758 missense probably benign
R1616:Rbm15 UTSW 3 107330881 missense probably benign
R1708:Rbm15 UTSW 3 107331220 missense probably damaging 1.00
R1944:Rbm15 UTSW 3 107331552 missense probably damaging 1.00
R2519:Rbm15 UTSW 3 107330833 missense probably benign 0.08
R3432:Rbm15 UTSW 3 107330677 missense probably benign 0.32
R4885:Rbm15 UTSW 3 107332254 missense probably benign 0.25
R6915:Rbm15 UTSW 3 107332311 missense probably benign 0.07
R7336:Rbm15 UTSW 3 107333116 start gained probably benign
R7799:Rbm15 UTSW 3 107332143 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGCTGAGAGAACTCACAAGG -3'
(R):5'- GCAACTTCCCTTCCAACATG -3'

Sequencing Primer
(F):5'- CTCACAAGGTGGGAAGGCATG -3'
(R):5'- TGACCTCCAAGTTGCTAGCAG -3'
Posted On2016-09-01